“Children born small for gestational age (SGA) are at increased risk of metabolic alterations, such as insulin resistance and dyslipidemias, which may predispose them to metabolic syndrome. Although effective in promoting growth in SGA children who do not exhibit catch-up growth, growth hormone (GH) therapy raises concerns regarding potential metabolic impacts. The aim of the present study was to systematically investigate the effects of GH treatment on metabolic outcomes in SGA children. A literature search was conducted with no restrictions on date or language in the PubMed, Web of Science, Scopus, and gray literature sources. Descriptors related to GH treatment, SGA children, and metabolic outcomes were used. Clinical trials, quasi-experimental studies, and crosssectional studies were included. Study screening and reference management were performed using the Rayyan platform. The studies showed that GH treatment increases height, weight, and growth velocity, bringing final height closer to the genetic target. Treatment was found to promote an initial increase in insulin resistance, with elevated insulin and HOMA-IR values, but without concomitant changes in blood glucose. Improvements in body composition were observed, including increased lean mass and proportional reduction in fat mass. Results regarding lipid profile and other metabolic parameters were heterogeneous and generally not clinically significant. Based on the findings of this review, GH treatment is considered safe for SGA children. The initial reduction in insulin sensitivity tends to be transient and is associated with improvements in body composition. The overall safety profile was favorable, with no evidence of significant metabolic impairment. ”

“Introduction: Diabetic retinopathy is one of the most common microvascular complications of diabetes and is the leading cause of acquired blindness in working-age adults worldwide. Among the microangiopathic changes of the disease, we find the increase in the Foveal Avascular Zone (FAZ), a region of the retina located in the center of the macula and responsible for central vision. Objectives: To study the relationship between the increase in the FAZ and the loss of central vision in patients with diabetic retinopathy. Material and Methods: An analytical, observational, crosssectional study was carried out, in which the area of the FAZ was measured through Optical Coherence Tomography Angiography (OCTA) and the findings were correlated with the loss of central vision, measured by Snellen chart and later converted to LogMAR, of diabetic patients treated at the retina outpatient clinic of the Fundação Banco de Olhos de Goiás (Fubog). Partial results: To date, 31 eyes of patients with diabetic retinopathy have been studied and a positive correlation was found between loss of visual acuity (LogMAR) and the increase in the foveal avascular zone (FAZ) in the superficial and deep retinal plexuses. For the superficial plexus, a moderate and statistically significant positive correlation was found (Pearson's correlation coefficient (r): 0.41 and p: 0.0211). For the deep plexus, a moderate-to-strong and statistically significant positive correlation was found (Pearson's correlation coefficient (r): 0.49 and p: 0.0053). Conclusion: In patients with diabetic retinopathy, there is a positive and statistically significant correlation between the increase in the area of the foveal avascular zone, both in the superficial and deep plexuses, and the decrease in visual acuity (increase in LogMAR). The effect is more pronounced in the deep plexus. Data collection is still being processed and a new data analysis will be performed with a larger number of eyes.”

“Endometrial cancer (EC) is a gynaecologic neoplasm with a high incidence, associated with significant rates of mortality and morbidity among women. Its etiology has not been fully elucidated, however, metabolic and hormonal alterations are recognized for being related to its development. The primary recommended treatments are invasive surgical procedures, which may result in infertility, highlighting therapeutic limitations in specific scenarios and the need for alternatives with a better efficacy and safety profile. In this regard, metformin has been considered a promising candidate as an adjuvant treatment and is being studied to address gaps in the molecular mechanisms that may clarify its potential antitumor activity. Therefore, to expand the understanding of metformin’s mechanisms of action, the objective of this study was to investigate its effects, particularly on pathways associated with cell proliferation, through in vitro experiments and a systematic literature review. In the experimental assays, Ishikawa cells were treated with metformin (0.5, 15, and 40 mM for 48 hours), and the protein expression of AMPK, HIF1α, NFκB, and p70S6K was assessed by Western blot. The results indicated modulation of p70S6K and HIF1α under treatment with high concentration of metformin (40 mM), with no changes at low and intermediate concentrations, while AMPK and NFκB showed no significant differences under any condition. The systematic literature review followed the PICOS approach and included experimental studies in preclinical animal and cellular models of ECr, with metformin as a single intervention. The results from the systematic review corroborate metformin’s antiproliferative and pro-apoptotic effects in EC, as well as its ability to modulate cell cycle and several genes and proteins. Taken together, these findings suggest that metformin has potential as an adjuvant treatment for EC, while highlighting the need for further studies to deepen the understanding of its antitumor activity and to align laboratory findings with therapeutic dosing.”

Endodontic treatment aims to disinfect the root canal system and properly prepare it for obturation, with calcium hydroxide being the most widely used intracanal medication. However, new bioceramic materials have been proposed to enhance antimicrobial activity and biological response in periapical tissues. This study aimed to integrative evaluate the elemental composition, antimicrobial activity, and biological effects of Bio-C Temp and UltraCal XS on peripheral blood mononuclear cells (PBMCs) and human periodontal ligament cells (hPDLSCs). Elemental composition was determined by X-ray fluorescence, while calcium ion release and pH variation were monitored at different experimental periods. Antimicrobial activity was assessed against Enterococcus faecalis, Staphylococcus aureus, and Candida albicans by determining the minimum inhibitory concentration and the minimum bactericidal and fungicidal concentrations. Biological evaluation included cell viability assays using the MTT method, cell proliferation assessed by trypan blue exclusion assay, cell migration by the scratch assay, nitric oxide production quantified by the Griess method under inflammatory stimulation with lipopolysaccharide (LPS) and LPS associated with interferon gamma (IFN-γ), morphological analysis by scanning electron microscopy, and gene expression analysis of inflammatory cytokines by real-time polymerase chain reaction. Both materials showed calcium as the main component, with a predominance of barium in UltraCal XS and tungsten in Bio-C Temp, in addition to secondary radiopacifiers. UltraCal XS exhibited higher initial calcium ion release and greater alkalinity, whereas Bio-C Temp showed more stable ion release over time. Both materials inhibited the growth of E. faecalis and showed partial inhibitory effects against S. aureus, with greater efficacy observed for UltraCal XS, while only this material exhibited antifungal and fungicidal activity against C. albicans. UltraCal XS maintained PBMC viability above 97% at all dilutions, whereas Bio-C Temp showed significant cytotoxicity at higher concentrations, with progressive recovery at higher dilutions. In hPDLSCs assays, both materials reduced cell viability at higher concentrations, with recovery at higher dilutions. UltraCal XS stimulated cell migration and proliferation, whereas Bio-C Temp significantly inhibited these parameters at higher concentrations. Both materials modulated the expression of TNF-α, IL-1β, IL-6, and IL-10 in a stimulus-dependent manner. It is concluded that UltraCal XS presents a more favorable biological profile, whereas Bio-C Temp, despite its adequate physicochemical properties, exhibits greater cytotoxicity and negative effects on cell migration and proliferation at higher concentrations.

“People experiencing homelessness constitute one of the most socially vulnerable groups in the Brazilian context, marked by profound social inequalities and persistent barriers to access to fundamental rights, including health care. Although the Brazilian legal framework recognizes health as a universal right and includes specific public policies for this population, significant challenges remain regarding the effectiveness of these actions in addressing health problems and reducing health inequities. This study aims to map and analyze the available evidence on the results and impacts of public health policies on the health–disease process of the homeless population in Brazil. This is a scoping review conducted in accordance with the Joanna Briggs Institute (JBI) guidelines and the Preferred Reporting Items for Systematic reviews and Meta-Analyses (PRISMA), with a previously registered protocol on the Open Science Framework platform. The search strategy was applied to the PubMed, SciELO, and BVS/LILACS databases, including publications from the last ten years in Portuguese, English, and Spanish. The selected studies indicate that, despite normative and institutional advances such as the National Policy for the Homeless Population and the implementation of Street Outreach Clinics, significant gaps persist in ensuring comprehensive care, continuity of health services, and intersectoral policy coordination. The impacts of the analyzed policies were heterogeneous and strongly influenced by contextual, institutional, and social factors, including stigma, fragile care networks, and structural limitations of health services. It is concluded that public health policies targeting the homeless population have relevant potential to mitigate health inequities; however, their effectiveness remains constrained by operational challenges and insufficient integration among sectors. This study contributes by systematizing existing knowledge, identifying gaps in scientific production, and supporting the improvement of policies and practices aimed at promoting equity in health care for this population.”

“Pancreatic adenocarcinoma is one of the most lethal neoplasms, and the combination of gemcitabine (GEM) with olaparib (OLA) coencapsulated in nanosystems shows promise as an excellent treatment alternative for this disease, particularly in patients with BRCA gene mutations. This work presents the validation of a simple, fast, and sensitive chromatographic method for the simultaneous analysis of GEM and OLA. Efficient chromatographic separation of GEM and OLA was achieved using a C18 column (250 × 4.6 mm, 5 μm) with a mobile phase composed of acetonitrile and water (50:50, v/v), eluted isocratically at a flow rate of 0.8 mL/min. Determinations were performed using a DAD detector at 243 nm for both drugs. Retention times for GEM and OLA were approximately 3.3 and 4.3 min, respectively. The method showed linearity (r²>0.999), with a regression curve in the concentration range of 0.5 to 10.0 μg/mL, demonstrating sensitivity, precision, and accuracy. Drug recovery rates in pancreatic tissues were greater than 97.0%. The components of the coated liposomal formulation and the pancreatic tissues did not interfere with the analysis, and both drugs showed a low degradation rate under adverse conditions. Furthermore, this work presents the development and characterization of liposomes with and without chitosan oligosaccharide coating. The developed liposomes have an average size (hydrodynamic diameter) of 113 ± 0.46 nm without coating and 114.9 ± 1.84 nm with chitosan oligosaccharide coating, with variations from 110 to 230 nm for both particles. The PdI values are 0.09 ± 0.01 and 0.08 ± 0.02 for uncoated and coated liposomes, respectively. The developed coated liposomes have negative zeta potentials of -7.11 ± 0.43 mV and - 7.66 ± 0.70 mV. The pH of the composition with uncoated and coated liposomes is 7.54 ± 0.02 and 7.58 ± 0.00, respectively, which is close to the physiological pH range. The encapsulation efficiency for liposomes is 49.69 ± 2.16% and 48.56 ± 0.26% for GEM, in coated and uncoated liposomes, respectively, and 79.21 ± 0.22% and 81.51 ± 0.13% for OLA, in coated and uncoated liposomes, respectively. In these liposomal systems, GEM released 73 ± 0.71% and 84 ± 2.90%, and OLA 95 ± 1.56% and 70 ± 1.98%, respectively, in six hours. In HETCAM assays, the coated and uncoated liposomal formulations showed no irritant potential, with irritability indices of 0.0 ± 0.0 and 0.0 ± 0.0 for both formulations and 19.0 ± 0.2 and 0.0 ± 0.0 for the negative and positive controls, respectively. Coated and uncoated liposomes did not show significant changes in hydrodynamic size, PdI, zeta potential, and pH values after 90 days of observation (p > 0.05). In vitro assays showed decreased viability of cells derived from pancreatic cancer, Panc-1, MIA PaCa-2, and BxPC3. In an in vivo model using the chorioallantoic membrane (CAM) of chicken egg embryos, treatment with liposomes promoted a 50% reduction in the area of tumors developed from Panc-1 and BxPC3 xenografts. In conclusion, coated liposomes containing GEM and OLA present themselves as a promising and innovative alternative for the treatment of pancreatic cancer.”

“Introduction:Cancer patients undergoing radiotherapy treatment in the head and neck region experience various acute and chronic toxicities in the oral cavity,including radiation caries,which,if left untreated,can lead to premature tooth loss, infection, and osteoradionecrosis. Objectives:To evaluate the use of Photodynamic Therapy (PDT) with methylene blue photosensitizer in the restorative treatment of patients with radiation caries.Retorations (with and without PDT) performed on radiation caries were clinically analyzed by comparing the clinical characteristics of the restorations and observing their duration over a period of 2 years.The null hypothesis is that PDT with methylene blue does not influence the durability of resin restorations. Materials and methods: In this clinical study,seven patients were selected,five men and two women, who had received radiation therapy in the head and neck cancer region.The sample consisted of 55 pairs of restorations that were evaluated using modified USPHS/RYGE(United States Public Health Service/Restorative and Prosthetic Dentistry Group) criteria to assess the duration and clinical characteristics of the restorations:marginal retention,marginal adaptation,restoration staining, and secondary caries. Results:Retention failure and restoration loss were the most common failures,mainly on the restoration side without PDT use. In one clinical case, the durability of the restorations was much higher on the side where photodynamic therapy was used.Other patients had failures in a small number of restorations without PDT use. In incisal regions, failures occurred on both sides, and some patients had no failures on either side. Conclusion:PDT with methylene blue may be an adjuvant treatment that appears to influence the duration of restorations in radiation caries.

“_The judicialization of health care constitutes a structural phenomenon in Brazil, intensified during the COVID-19 pandemic, a period in which judicial decisions began to directly interfere in the organization of the health system, in access to treatments, and in the formulation of public policies. The general objective of this study is to conduct a critical investigation of the bioethical challenges inherent to the judicialization of health care in the context of the COVID-19 pandemic, seeking to understand this phenomenon in its legal, ethical, and health-related dimensions. The investigation adopts a qualitative, exploratory, and analytical approach, with thematic content analysis of judicial decisions, selected through systematic sampling (k=18) from a universe of 17,537 judicial cases identified on the AASP®/JUIT® platform, of which 585 comprise the final sample after the application of eligibility criteria, deduplication, and exclusion. The systematic analysis of the rulings allowed for the construction of four analytical categories: access to ICU beds and scarcity of health resources; federative conflicts and management of the Unified Health System; provision of medications in the context of the pandemic; and compulsory vaccination and individual autonomy. The results show that judicialization, although it functions as a mechanism to correct state omissions, produces significant tensions regarding equity, the allocation of scarce resources, and the sustainability of the health system. It is concluded that judicialization operated simultaneously as an instrument for guaranteeing individual rights and as a factor of systemic tension, revealing distinct decision-making patterns across the four analyzed axes and a gradual process of institutional maturation of the Judiciary, reinforcing the need for bioethical parameters to guide judicial decisions in future public health emergency contexts._”

Introduction: The impact of single-sided deafness for the patients has often been underestimated, as it was believed that the normal contralateral ear would compensate for the deficits of the other side. Nowadays it is known that a particularly increased effort is required to compensate for it in complex listening environments, leading to a reduced performance and an increased hearing handicap. Otopathology allows the study of diseases affecting the ear and it is the gold standard for evaluating intracochlear pathology, providing sensitive and specific identification of pathophysiological mechanisms. Objectives: To evaluate the histopathological findings of unilateral hearing loss and spiral ganglion cell counts, comparing them to the normal contralateral ear, and discussing implications of these findings for auditory rehabilitation. Methods: This study included 88 ears from 44 human subjects with a diagnosis of severe to profound unilateral hearing loss, from the Temporal Bone collection of the Otopathology laboratory of Massachusetts Eye and Ear Infirmary, with age ranging from 5 to 90 years old. Within the study group, we included 6 different etiologies of hearing loss: sudden sensorineural hearing loss, Meniere’s disease, internal auditory canal tumors, chronic otitis media, stapes fixation and central nervous system disorders. Results: The analysis for all causes of unilateral severe to profound sensorineural hearing loss showed that the loss of spiral ganglion cells was directly correlated with the loss of neural fibers (dendrites and axons) in all cochlear turns (p<0.001). The duration of hearing loss (in years) did not show a direct correlation with neuronal loss in the spiral ganglion, which may indicate that even with a longer time of hearing deprivation, depending on the etiology, cochlear implantation may be an effective measure for rehabilitation. On the other hand, inner ear surgeries (including cochleosacculotomy, labyrinthectomy, lateral canal fenestration, stapedectomy, stapedotomy, manipulation of the internal auditory canal and iatrogenic injury to the lateral semicircular canal) were positively correlated with spiral ganglion atrophy (p=0.013), suggesting that rehabilitation should be near or at the same surgical time, for a better prognosis. There is a correlation between unilateral loss and abnormalities of the organ of Corti (p<0.001), atrophy of the stria vascularis (p=0.002) and atrophy of the vestibular sensory organs (p<0.001). Evaluation of the ‘inner ear disease’ subgroup, excluding middle ear and central nervous system disorders, was positively correlated with some degree of hydrops (p<0.001), tectorial membrane abnormalities (p=0.001) and Scarpa’s ganglion atrophy (p=0.002). Inner ear surgery for this group was also correlated with spiral ganglion atrophy (p=0.008), and fibrosis (p=0.006) or ossification (p=0.005) of the cochlear lumen. In the Meniere’s disease subgroup, there was no correlation between hydrops and the percentage of neuronal loss (versus control), supporting the theory that hydrops is in fact an adaptive mechanism to an inner ear insult rather than the cause of hearing loss. In the internal auditory canal tumor subgroup, spiral ganglion degeneration appears to occur regardless of the intervention, even when the approach was retrosigmoid. Conclusion: The multiple causes of unilateral hearing loss have different histopathological implications in the inner ear, which may reflect in different outcomes for auditory rehabilitation.

“Objective: The objective of this systematic review is to critically analyze the available evidence in the literature regarding the association between academic performance and metabolic control in children with type 1 diabetes mellitus (T1D), aiming to clarify the relationship between these variables and identify gaps for future research. Method: This study adhered to PRISMA guidelines, employing a search strategy across PubMed, Scopus, Web of Science, and Google Scholar databases. The methodological quality of the studies was assessed using the Joanna Briggs Institute tool. Results: The review analyzed 13 studies on the impact of type 1 diabetes (T1D) on academic performance, covering 76,670 individuals with T1D and healthy control groups. A significant correlation was observed between adequate glycemic control and better school performance, while frequent episodes of hypoglycemia and hyperglycemia were associated with deficits in attention, memory, and executive functions. Students diagnosed early or with a longer duration of T1D experienced greater academic difficulties, particularly in mathematics and reading. Factors such as metabolic stability, use of management technologies, and socioeconomic context were highlighted as influential. Conclusion: T1D is associated with academic impairments influenced by glycemic control, age of onset, and contextual factors. Effective management strategies and educational support are crucial to mitigate these impacts and promote cognitive and academic performance. Future studies should standardize methodologies to better understand the relationship between T1D and learning"

The current study aimed to examine the expression of microRNA 7 (miR-7) and the enzyme poly(ADP-ribose) polymerase 1 (PARP1) in a model of dopaminergic cell injury using SHSY5Y cells exposed to MPP+. miR-7 plays a neuroprotective role in the underlying mechanisms of Parkinson's disease (PD) by reducing the accumulation of synuclein in Lewy bodies, as well as mitigating oxidative stress and apoptosis, among other factors. Moreover, miR-7 triggers the post-transcriptional silencing of the enzyme PARP1, thereby regulating its content. PARP1, in turn, has been implicated in the death of dopaminergic neurons in PD through the parthanatos pathway, which generates PAR polymers that interact with misfolded alpha-synuclein molecules, increasing the deposition of this protein in Lewy bodies. In this context, PARP1 inhibitors have proven effective in preventing the increase of PAR polymers and in attenuating motor deficits in animal models of experimental parkinsonism. Our group has already demonstrated that rotenone-induced parkinsonism results in a reduction of miR-7 in the striatum, accompanied by loss of dopaminergic neurons and motor impairment. The present study investigates whether this reduction of miR-7 is correlated with an increase in PARP1 expression and whether miR-7 supplementation through synthetic mimics (miR-7 mimics) could mitigate the effects of the neurotoxin MPP+, suggesting a neuroprotective effect. The cells were cultured in DMEM medium supplemented with fetal bovine serum (FBS), Glutamax, and an antibiotic/antimicrobial solution, and exposed to MPP+ for 24 hours. Cell viability was assessed through the MTT colorimetric assay, while miR-7 expression was determined by RT-qPCR. RNA was purified using commercial kits (RNeasy Plus Mini kit, Qiagen, and mirVana™, Invitrogen). For RT-qPCR of miRNAs, cDNA synthesis and qPCR were performed using the TaqMan™ MicroRNA Reverse Transcription and TaqMan™ Fast Advanced Master Mix kits. For PARP1 RT-qPCR, cDNA synthesis and qPCR were carried out with random primers (SuperScript II First-Strand Synthesis System, Invitrogen) and the SYBR Green method (Fast SYBR Green Master Mix, Applied Biosystems). Data were analyzed using the ∆∆Ct method, normalizing with endogenous genes and spike-ins. Exposure to MPP+ resulted in a significant, dose-dependent reduction in cell viability at concentrations of 0.5 mM, 1.0 mM, 2 mM, and 4 mM, with reductions of 87%, 81%, 59%, 34%, and 15%, respectively (P<0.05). Regarding miR-7, SH-SY5Y cells exposed to 1 mM MPP+ for 24 hours showed a reduction of miR-7 to 0.690 (1 mM) and 0.461 (2 mM). PARP1 expression was also analyzed using RT-qPCR, with GPB1 and GAPDH as calibrators. Our data indicate a decrease of 0.862 times in PARP1 expression in SH-SY5Y cells exposed to 1 mM, and a decrease of 0.790 times in cells exposed to 2 mM of MPP+ for 24 hours. In conclusion, the results demonstrate the reduction of gene expression of miR-7, a microRNA directly involved in controlling the most studied pathological protein in PD, alpha synuclein. This finding reinforces the role of miR-7 in the neuropathology of Parkinson's disease, considering that the decrease in miR-7 may result in the accumulation of the protein it regulates. Additionally, alterations in the expression of the enzyme PARP1 may lead to cellular changes that result in the death of dopaminergic cells. Thus, the present study highlights the potential role of two molecules involved in the underlying mechanisms of PD, contributing to a better understanding of this neurodegenerative disease and suggesting potential targets for innovative therapies aimed at slowing its progression. 

“Epilepsy is one of the major chronic neurological disorders, affecting approximately 50 million people worldwide. It is characterized by a reduced threshold for excitation in neuronal circuits, with epileptic seizures resulting from abnormal synchronous neuronal discharges. Despite the availability of several antiepileptic drugs, many cause significant side effects or fail to effectively control seizures, highlighting the need for new treatments. In this context, a bioinspired peptide derived from the venom of the wasp Polybia occidentalis, named neurovespin, was developed and demonstrated protection against chemically induced seizures in mice. Currently, neurovespin is undergoing registration for use in dogs and cats with refractory epilepsy and has been licensed to the biotechnology company Biointech. Despite its antiepileptic efficacy, neurovespin has a short half-life, requiring frequent administration. Studies suggest that peptide glycosylation, particularly tyr-O-glycosylation, can significantly improve peptide stability and biological activity. To enable this modification, neurovespin was structurally altered with the addition of a tyrosine residue, resulting in neurovespin(tyr). This project aimed to glycosylate neurovespin(tyr) and evaluate its neuroprotective effect in an acute seizure model induced by pentylenetetrazol (PTZ) in mice, complemented by behavioral and electroencephalographic (video-EEG) analyses. Furthermore, the acute in vivo toxicity of the neurovespin, neurovespin(tyr), and neurovespin(gly) variants was assessed. To achieve this, the glycosylated peptide was synthesized, purified, and characterized using reverse-phase liquid chromatography (HPLC) and mass spectrometry (MS). Subsequently, toxicity and neuroprotective effect assays were conducted in animal models, providing a comprehensive analysis of the therapeutic potential of modified neurovespin.”

“Background: Herbal extracts and plant bioactive compounds have been shown to improve several metabolic outcomes. Objective: We conducted a systematic review and meta-analysis of randomized controlled trials (RCT) to examine the effect of herbal extracts and plant bioactive compounds on insulin resistance (IR) in women with polycystic ovary syndrome (PCOS). Search methods: We searched Pubmed, Web of Science, Scopus, and LILACS from inception until October 15, 2024. Selection criteria: We included RCT addressing the effect of herbal extracts and plant bioactive compounds in women with IR. Data collection: We analyzed the data qualitatively and quantitatively, the latter using a random-effects model, with standardized mean difference (SMD) and 95%CI as summary statistics. Main results: Among the 39 included RCT, curcumin, cinnamon, and berberin were the most frequently assessed herbal extracts/compounds, with the majority of studies showing their beneficial effect on IR in women with PCOS. Curcumin had a neutral effect on HOMA-IR (SMD: -0.07, 95%CI: -0.34, 0.19, p = 0.59, I2: 0%, low certainty) and QUICKI (SMD 0.08, 95%CI -0.23, 0.38, p = 0.62, I2: 0%, low certainty), and cinnamon marginally improved HOMA-IR (SMD: -0.39, 95%CI -0.77, 0.00, p = 0.05, I2: 41%, low certainty). Conclusions: Our findings suggest cinnamon may improve IR in PCOS, albeit with a low certainty of evidence. However, current evidence for other herbal extracts/compounds is not conclusive. The shortcomings in our review highlight the need for further clinical trials to establish the clinical efficacy of herbal extracts and plant bioactive compounds for the treatment of IR in PCOS."

Introduction: Hearing loss in adults is a chronic condition that can severely affect quality of life and limit participation in everyday activities. Cochlear implant (CI) candidates who opt for surgery face a process full of anxiety and high expectations. Therefore, the use of the Expectations Questionnaire may facilitate the use of the device. Purpose: to translate, culturally adapt and validate the Cuestionário de Expectativas para adultos (CEA) ao Implante Coclear to brazilian portuguese and to evaluate its psychometric properties in a sample of adults with indication for cochlear implant surgery. Methods: An analytical and descriptive study was carried out. Stages included translation, back-translation, adaptation and validation of the CEA. It included 119 participants who answered the questionnaire. In order to identify if the questions were clear enough, Content Validity Index (CVI) and Exploratory Factor Analysis (EFA) were used for analyses. Reliability was assessed with Cronbach's Alpha, McDonald's Omega and Composite Reliability coefficients, using Item Response Theory (IRT). Results: The questionnaire had a total CVI of 0.974, showing good comprehension by all participants, and high values for three internal consistency coefficients (⍺ = 0.828; ω = 0.854; CC = 0.900). The questionnaire showed great levels of consistency and validity measures to be applied on a high scale. However, items Q2, Q3 and Q13 went under revision to be reformulated for the final version. Conclusion: The validity and reliability of the instrument were confirmed. Therefore, the Cuestionario de Expectativas ao implante coclear para adultos (CEA) instrument was translated, adapted and validated for Brazilian Portuguese.

“Intellectual disability (ID) affects approximately 1%-3% of the global population, regardless of ethnicity or socioeconomic status, and represents a significant public health challenge. It is a highly heterogeneous condition, both in terms of etiology and clinical presentation, characterized by substantial impairments in intellectual functioning and adaptive behavior. Advances in health care, sanitation, and nutrition have heightened interest in understanding the genetic basis of ID, which accounts for an estimated 25%–50% of cases. However, despite recent progress in variant identification and analysis, the majority of individuals with ID still lack a definitive molecular diagnosis. In this context, the present study aimed to investigate the genetic etiology of ID in a cohort of 16 individuals with a 46, XY karyotype, all presenting with syndromic ID, who were selected from the Ambulatório de Genética Clínica at the Hospital Universitário de Brasília. Whole-exome sequencing (WES) was employed as the primary diagnostic approach, yielding a diagnostic success rate of 75.0% (12/16). For individuals in whom exome analysis did not identify causative variants, potentially relevant candidate variants were proposed. This study aligns with global efforts to employ next-generation sequencing as a diagnostic tool for genetic conditions. Over the years, this set of techniques has become increasingly robust, not only enhancing diagnostic accuracy but also enabling the re-analysis of previously inconclusive results. ”

“Recognition memory is the ability to discriminate between new and familiar stimuli in the environment. It plays a key role in the decision-making process and helps plan future behaviors. The Spontaneous Object Recognition (SOR) and the Spontaneous Object-Location (ROL) tests are tools commonly used to assess this type of memory in animals. Although these tests have been traditionally performed in rodents, their use in non-human primates is currently increasing. The latter are viewed as a more translational model due to their greater neuroanatomical and behavioral similarity with humans. Given that these behavioral tasks can be influenced by several aspects, such as the time spent becoming familiarized with the stimulus, more studies are needed in monkeys. The present study thus aimed to assess the influence of the initial familiarization phase on the recognition memory of adult capuchin monkeys (Sapajus spp.). The SOR and SOL tests were used, as well as different retention intervals (RI). All subjects were individually tested in their own home-cages. Each test consisted of a sample trial that lasted until a pre-established familiarization time was attained (5 s or 20 s), followed by a RI (10 min or 24 h) and a 5 min test trial. Thus, each subject was submitted to four SOR tests and four SOL tests, one for each familiarization time and RI. For the SOR tests, the subject was exposed to two identical copies of a same object during the sample trial, while in the test trial there was a copy of the familiar item alongside a new object. For the SOL tests, the subject was exposed to two identical copies of a same object during both trials. However, in the test trial, one object was placed in a different location from where it had been previously seen. A distinct set of objects was used for each test. In the SOR test, the subjects demonstrated a recognition memory. When the sample trial required a 5 s object familiarization time, they spent more time exploring the new object than the familiar item, but only after the 24 h RI. When the familiarization time was set at 20 s, the same novelty preference was seen, yet after both RI (10 min and 24 h). In the SOL test, the capuchin monkeys spent more time exploring the displaced object than the item that remained stationary, thus demonstrating a spatial recognition memory. However, this effect was seen only when the sample trial had a 20 s object familiarization time, regardless of the RI (10 min and 24 h). Duration of the sample trial and total object exploration time in the test trial did not differ between the four versions of the SOR test or the SOL test that were held. These results suggest that a 20 s versus 5 s familiarity time with a stimulus facilitates both short- and longer-term recognition memory in adult capuchin monkeys, particularly for the tasks that have a greater cognitive demand, such as spatial recognition.”

Parkinson’s disease (PD) is a progressive neurodegenerative disorder characterized by the selective loss of dopaminergic neurons in the substantia nigra and the presence of Lewy bodies, leading to motor, cognitive, and emotional impairments. Studies suggest that microRNAs (miRNAs) are potential modulators of the pathological processes involved in PD, such as oxidative stress, neuroinflammation, and neuronal apoptosis. Among these, miR-671 has emerged for its regulatory effects on inflammatory pathways. This study aimed to investigate the role of miR-671 in an in vitro neurodegeneration model induced by MPP⁺ and rotenone, using SH-SY5Y cells.

Cell viability was assessed by MTT and CCK-8 assays after exposure to different concentrations of MPP⁺ (0.5 to 2.0 mM) and rotenone (0.1 mM) for 24, 48, and 72 hours. The results showed a significant, time- and dose-dependent reduction in cell viability, with a more pronounced effect at higher concentrations and prolonged exposure. The CCK-8 assay proved to be more sensitive and reproducible, with optimal reading between 3 and 5 hours.

miR-671 expression was quantified by RT-qPCR in cells exposed to 1 mM MPP⁺ for 24 hours. A significant increase in miR-671 expression was observed (mean = 1.448) compared to the control group (mean = 0.878; p < 0.05). These findings suggest that miR-671 may be involved in the cellular response to neurotoxic insult, possibly playing a neuroprotective role. The results reinforce the relevance of miRNAs as potential therapeutic targets and promising biomarkers for PD.

“Thermogenic adipocytes present a promising therapeutic strategy for metabolic diseases. While murine models have provided valuable insights into thermogenic adipose tissue, their relevance to human physiology is constrained by species-specific differences in tissue distribution and thermogenic capacity. In vitro human models offer a more controlled platform to study adipocyte differentiation, addressing challenges such as limited access to deep fat depots and individual variability. This systematic review summarizes the current literature on human in vitro models for thermogenic adipocyte induction, encompassing 117 studies involving primary human adipocyte progenitors differentiated into thermogenic adipocytes in 2D cultures. Most studies relied on classical adipogenic inducers, including isomethylbutylxanthine, dexamethasone, and insulin, with additional use of triiodothyronine, rosiglitazone, or indomethacin. A few studies incorporated adrenergic stimulation or exposure to lower temperatures to simulate cold exposure. Notably, some studies demonstrated successful differentiation under serum-free, chemically defined conditions, highlighting their potential for reproducibility and translational relevance. A key limitation remains the predominant reliance on gene expression as the primary outcome, with few studies assessing mitochondrial respiration or broader metabolic functions. Moving forward, the development and adoption of standardized, functionally validated protocols will be critical to fully realize the potential of human in vitro thermogenic adipocyte models in metabolic research.”

Parkinson's Disease (PD) is a chronic neurodegenerative disorder that affects movement and may also impair cognition. It is pathologically characterized by the loss of dopaminergic neurons in the nigrostriatal network and by the formation of Lewy bodies, resulting from alpha-synuclein aggregation and intracellular deposition. Regulatory RNAs, including long non-coding RNAs (lncRNAs), circular RNAs (circRNAs), and microRNAs (miRNAs), are functionally related and involved in the pathophysiology of PD. Cyrano is an lncRNA (also known as OIP5-AS1) that participates in embryonic development, acting in processes such as proliferation, apoptosis, and mitosis, and may be involved in neurological diseases, inflammatory disorders, and cancer; one of its important molecular functions is the ability to interact with miR-7, potentially promoting its degradation due to a complementary binding site. The circular RNA CDR1as (Cerebellar degeneration-related protein 1 antisense RNA) is one of the most well-characterized circRNAs, highly expressed in the mammalian brain, with over 70 binding sites for miR-7, acting as a miR-7 "reservoir." Another relevant microRNA is miR-671, which contributes to the pathogenesis of several diseases, including PD; this microRNA negatively regulates the CDR1as gene via AGO2, therefore making it part of the miR-7 regulatory network, along with CDR1as and Cyrano. The present study aimed to investigate the expression of Cyrano, CDR1as, miR-7, and miR-671 in an in vitro model of MPP+-induced dopaminergic neurodegeneration, using SH-SY5Y cells. Exposure of SH-SY5Y cells to MPP+ for 24 hours caused a dose-dependent reduction in cell viability of 87.30%, 81.20%, 58.7%, 34.2%, and 15% at the respective concentrations of 0.25 mM, 0.5 mM, 1 mM, 2 mM, and 4 mM. Indeed, a significant increase in oxidative stress was also observed at MPP+ concentrations of 0.5 mM, 1.0 mM, and 2.0 mM, along with morphological changes typical of apoptosis, such as nuclear condensation and fragmentation. The apoptotic nuclei count revealed that apoptosis was dose-dependent (P<0.05). Finally, RT-qPCR expression analysis showed a significant dysregulation of the regulatory network in the MPP+-exposed groups. We observed a 2.04-fold increase in CDR1as expression (P=0.0083) and a 0.439-fold and 0.613-fold reduction in miR-671 and miR-7 expression, respectively (P<0.05). Cyrano, in contrast, did not show a statistically significant difference in gene expression. The results demonstrate that MPP+- induced toxicity affects the miR-7 regulatory network and suggest the involvement of these ncRNAs in cell viability loss, indicating them as potential biomarkers and promising targets for neuroprotective therapies. Further silencing studies and analysis in patient samples are necessary to confirm the role of these RNAs in the degeneration of dopaminergic neurons.

“Introduction: Mortality during the pregnancy-puerperal cycle and in infancy among Indigenous peoples in Brazil is a serious public health problem, exacerbated by social inequalities and barriers to accessing services. Deaths from external causes, such as homicides, accidents, and suicides, are disproportionately high in this group and reflect structural and historical vulnerabilities. The lack of effective policies reinforces the need for in-depth studies. Objective: To analyze external and violent causes impacting mortality in the Indigenous pregnancy-puerperal cycle and infancy between 2015 and 2022, identifying patterns and comparing causes of death. Method: Descriptive observational study based on SINASC and SIM/DATASUS data. Deaths during the pregnancypuerperal cycle and in infants of individuals registered as Indigenous and classified as external causes according to ICD-10 were included. The Maternal Mortality Ratio in the pregnancypuerperal cycle (RMCGP) and the Infant Mortality Rate (IMR) were calculated, with historical trend analysis using linear regression. Results: Between 2015 and 2022, 29 deaths in the pregnancypuerperal cycle from external causes were recorded (average 3.6/year), mainly due to assault (31%), traffic accidents (28%), and suicide (24%). In the same period, 373 infant deaths occurred, 60.6% from assault and 25.5% from drowning. The RMCGP was 12.37 per 100,000 live births, and the IMR was 148.8 per 1,000, with peaks in 2015 and 2021. Indigenous peoples had the highest infant mortality rates from assault and drowning compared to other racial groups. Conclusions: The high incidence of Indigenous deaths from external causes in the pregnancy-puerperal cycle and infancy reflects historical vulnerability and neglect. Literature highlights that violence against Indigenous women and children, associated with territorial conflicts, socioeconomic precariousness, and exclusion from health services, demands urgent intersetorial actions to ensure equity and social protection. ”

“ Introduction: Rare diseases represent a significant public health challenge worldwide, affecting millions of people. With a wide range of symptoms and causes, it is estimated that there are between 6,000 and 8,000 different types of rare diseases, 80% of which are genetic in origin and 75% of which occur in childhood. In Brazil, around 13 million people live with this health condition. The aim is to strengthen national public policies and improve access to treatment for patients with rare and ultrarare diseases in Brazil. Objectives: To analyze the regulatory models and public policies related to rare diseases in Brazil, the United States and the European Union, in addition to investigating research protocols on the subject submitted to Plataforma Brasil between 2013 and 2023, presenting the profile of the studies and discussing the various forms of access to orphan drugs in Brazil. Methods: This descriptive study used a methodological approach that combined documentary research, analysis of official websites and a literature review, employing interpretative and statistical techniques in qualitative and quantitative approaches. The search covered official documents on public policies and ethical regulations, including legislation, guidelines, presentations and reports, with a focus on rare diseases. The sources consulted were the websites of the Ministry of Health, Anvisa, the European Medicines Agency (EMA) and the Food and Drug Administration (FDA). Results: The comparative analysis suggests that Brazil can adopt successful practices from the United States and the European Union, such as intersectoral partnerships, tax incentives and the involvement of patient associations. These findings indicate an increase in investment in research into rare diseases, which could boost the development of new therapies and the formulation of more effective public policies. The gradual harmonization of policies is especially advantageous for developing countries, improving the care of patients' needs. In Brazil, of the 1,500 research protocols analyzed, 9 were duplicates, resulting in 1,491 unique studies. Of these, 1,301 (87.26%) were approved, 38 (2.55%) were not approved and 152 (10.19%) were pending. The average sample size was 153 individuals, with a standard deviation of 817.03; the median was 22, with a minimum of 0 and a maximum of 20,000. Between 2013 and 2019, the number of studies increased, from 58 (4.46%) in 2013 to 160 (12.30%) in 2019. Although there was a decrease in 2020 and 2021, the number of studies grew again, reaching 176 in 2023. The statistical analysis revealed that 92.24% of the studies were single-center and 7.76% multicenter. In terms of study design, 87.78% were observational and 12.22% intervention/experimental. Conclusions: This study revealed the complexity and importance of public policies and regulatory models for rare diseases in Brazil, the United States and the European Union, and from a comparative analysis showed that Brazil can be significantly strengthened by adopting successful practices observed in the regions studied, such as intersectoral partnerships, tax incentives and the active involvement of social control. These elements are decisive for increasing investment in research into rare diseases, which in turn can drive the development of new therapies and the formulation of more effective public policies that meet the real needs of individuals, taking into account their socioeconomic, cultural and regional characteristics. Analysis of the research protocols submitted to Plataforma Brasil between 2013 and 2023 showed a significant increase in the number of studies, which may indicate an increase in interest and investment in research into rare diseases in Brazil. However, the variation in the number of studies over the years highlights the need for more stable and continuous policies to sustain this growth, which is reflected in our country through the fragility of having a “National Policy for Comprehensive Care for People with Rare Diseases (PNAIPDR), instituted in 2014 by the Ministry of Health, through Ordinance GM/MS No. 199, which does not give it the weight and stability of a federal law, although the data analyzed shows that Brazil has made progress in building public policies for rare diseases, but there are still challenges to be overcome, such as ensuring equitable access to orphan drugs, strengthening clinical research and promoting multidisciplinary care. In addition, the predominance of observational and single-center studies suggests the need for greater encouragement to carry out multicenter and intervention studies, which can provide more robust and generalizable data, which reinforces the importance and need for continuous support and adequate infrastructure to carry out high-quality research .”

“ Breast cancer is a complex and heterogeneous disease, with histologically similar tumors often displaying variable prognoses and therapeutic responses. Triple-negative breast cancer (TNBC) accounts for approximately 15% of all cases and is primarily treated with chemotherapy. The assessment of pathological complete response (pCR) following neoadjuvant chemotherapy is performed using the Residual Cancer Burden (RCB) index. Approximately one-third of TNBC patients achieve pCR, which is associated with a favorable long-term prognosis and a five-year disease-free survival rate exceeding 90%. In this context, mutations in genes involved in DNA repair pathways have been investigated as potential biomarkers to guide targeted therapies, such as poly (ADP-ribose) polymerase (PARP) inhibitors. Moreover, microRNAs have emerged as promising diagnostic and prognostic biomarkers due to their role in regulating gene expression via RNA interference, impacting both oncogenic and tumor suppressor pathways. This study investigated the expression profile of microRNAs and PARP1 in breast cancer cell lines and formalin-fixed paraffinembedded (FFPE) tumor samples from patients with TNBC, in addition to analyzing clinical and genomic data from The Cancer Genome Atlas (TCGA). The cell lines examined included MCF-7 (hormone receptor-positive, HR+), MDA-MB-231 (TNBC, BRCA1-proficient), and MDA-MB-436 (TNBC, BRCA1-mutated). Significant differences were observed in the expression levels of miR-7, miR-21, miR-671, and miR-146a among the cell lines, along with changes in response to paclitaxel treatment and PARP1 expression levels, which were correlated with the microRNA profiles. In FFPE tumor biopsies, miR-7, miR-21, and miR-146a were identified as potential predictors of pCR in TNBC patients. ”

“_Introduction: The strain on healthcare systems due to managing COVID-19 led to significant changes in the delivery of healthcare services. Elective and emergency surgeries were canceled or rescheduled, and obstetric and gynecological services were suspended so that the healthcare workforce and resources could be redirected to the population infected with COVID-19. Objectives: Evaluate the impact of the COVID-19 pandemic on birth rates, vaginal deliveries, cesarean sections (csections), and elective and emergency surgeries. The secondary objective was to compare maternal mortality before and after the pandemic, postoperative mortality in elective and emergency surgeries before and during the pandemic, and evaluate the impact of the COVID-19 pandemic on the cancellation of previously scheduled surgeries in a public hospital in the Federal District. Methods: Time-series cohort study including data of all patients admitted for elective or emergency surgery, as well as all women admitted for childbirth (vaginal delivery or c-section) at the hospitals and maternities in the Public Health System of Federal District, Brazil, between March 2018 and February 2022. The data were extracted from the Hospital Information System of the Brazilian Ministry of Health (SIH/DATASUS) on September 30, 2022. Causal impact analysis was used to evaluate the impact of COVID-19 on surgeries and childbirth using the CausalImpact R package, and a propensity score matching was used to evaluate the effect on maternal mortality rate using the Easy R (EZR) software. Partial results: There were 174,473 surgeries and 150,617 births during the study period. With the COVID-19 pandemic, there was a reduction in overall surgeries (absolute effect per week: -227.5; 95% CI: -307.0 to -149.0), elective surgeries (absolute effect per week: -170.9; 95% CI: -232.8 to -112.0), and emergency surgeries (absolute effect per week: -57.7; 95% CI: -87.5 to - 27.7). Comparing surgeries performed before and after the COVID-19 onset, there was an increase in emergency surgeries (53.0% vs. 68.8%, p < 0.001) but no significant change in hospital length of stay (p = 0.112). The effect of the COVID-19 pandemic on postoperative hospital mortality was not statistically significant (absolute effect per week: 2.1, 95% CI: -0.01 to 4.2). For childbirth, the overall effect of the COVID-19 pandemic was not statistically significant (absolute effect per week: 5.5, 95% CI: -24.0−33.4), but there was an increase in c- sections (absolute effect per week: 18.1; 95% CI: 11.9−23.9). After propensity score matching, COVID-19 was associated with increased maternal mortality (OR: 3.22, 95% CI: 1.53−6.81). The e-value of the adjusted OR for the association between the post-COVID-19 period and maternal mortality was 5.89, with a 95% CI: 2.43, suggesting that unmeasured confounders were unlikely to explain the entirety of the effect. Conclusion: The study showed a reduction in elective and emergency surgeries, a rise in c-sections, and maternal mortality during the COVID-19 pandemic, likely due to disruptions in surgical and maternal care services. These findings highlight the importance of implementing effective strategies to prevent the accumulation of surgical waiting lists and protect maternal health in times of crisis to improve outcomes for surgical patients, mothers, and newborns. ”

“Dacarbazine (DTIC) is the standard chemotherapy drug for the systemic treatment of melanoma, an invasive and aggressive form of skin cancer. However, its intravenous administration is related to several adverse effects, which could be overcome by topical application. Considering obstacles to the topical application of the drug, such as low stability and limited skin penetration, this work proposes to evaluate the effect of iontophoresis on the topical administration of DTIC. Initially, an analytical method using high-performance liquid chromatography was validated for quantifying the drug in the presence of skin contaminants. A reversed-phase C18 column was used as the stationary phase, and gradient elution of a mobile phase consisting of methanol and sodium phosphate monohydrate buffer pH 6.5 (0.01 mol/L) at a flow rate of 1.0 mL/min was implemented. DTIC was detected at 364 nm. The method was selective against cutaneous interferents, linear (r = 0.9995) in a concentration range of 1.0–15.0 μg/mL, accurate with an overall coefficient of variation less than 3.8%, accurate recovering between 91 -112% of the drug present in the skin layers, and sensitive with a detection limit of 0.10 μg/mL and a quantification limit of 0.30 μg/mL. Next, the skin permeation of the drug was evaluated with iontophoretic application. The electrical stability of the drug was evaluated before the iontophoretic experiments. Three current profiles (0.10, 0.25 and 0.50 mA/cm2) were tested through in vitro tests using porcine ear skin and diffusion cells, in which DTIC permeation was evaluated in solution and in solution. containing an antioxidant for 6 h. The results suggested that the instability of DTIC in the presence of current requires the use of an antioxidant that prevents its degradation. Different levels of current density can modulate and influence the extent of drug penetration and permeation. Furthermore, the presence of a competing ion, such as the added antioxidant metabisulfite, can reduce drug permeation under the low current of 0.10 mA/cm2. However, when increasing the current density to 0.25 mA/cm2 and 0.50 mA/cm2, the skin deposition of the drug increased considerably (p≤0.0001). Finally, the effect of DTIC on melanoma cell lines (MeWO and WM) was investigated after drug exposure and drug application of iontophoresis, after incubation for 72 h. The application of iontophoresis in cell cultures only decreased cell viability in the WM lineage at a concentration of 0.0125% of DTIC. The MeWo lineage was more sensitive to treatment: after application of 0.00625% DTIC, only 25% viable cells were found in each condition, while 45% viable cells were found in the WM lineage. The IC50 values were 0.0032% and 0.0037%, without and with electric current in the MeWo lineage, and 0.0079 and 0.0064% without and with electric current, in the WM lineage. Thus, it is partially concluded that the application of iontophoresis as a permeation promoter is a promising alternative to promote the topical application of DTIC for the treatment of superficial cancers, such as melanoma. This more targeted therapeutic option could, in addition to increasing the bioavailability of the active ingredient, reduce the adverse effects of this therapy.”

“Introduction: Intellectual disability (ID) is a neurodevelopmental disorder with a highly heterogeneous etiology, often associated with genetic alterations. Although several studies have addressed male patients, data on the genetic causes of ID in girls are still limited. Objective: This study aimed to investigate the genetic basis of ID in female patients through Chromosomal Microarray Analysis (CMA) and Whole Exome Sequencing (WES), seeking to identify pathogenic variants and contribute to the understanding of ID in girls. Methods: One hundred female patients diagnosed with syndromic or nonsyndromic ID and normal karyotype were selected. CMA was performed in all patients, while WES was applied to 24 of them, whose previous results were inconclusive. The detected variants were classified according to the ACMG guidelines. Results: CMA identified pathogenic or likely pathogenic variants in 24% of patients. WES detected relevant variants in 37.5% of patients analyzed, including pathogenic and likely pathogenic variants, increasing the overall elucidation rate of the cause of ID in the study to 32%. New genomic regions of interest were described, especially involving the X chromosome, reinforcing their relevance in cases of ID in girls. Conclusion: The combined use of CMA and WES significantly increases the diagnostic yield in female patients with ID, highlighting the importance of integrated genomic approaches. This study also highlights the need for further research focused on ID in girls, a population still underrepresented in the literature. Early genetic diagnosis allows for better clinical management, genetic counseling, and psychosocial support, in addition to contributing to the improvement of genomic databases and scientific knowledge.”

“The term adsorption is defined as the process in which molecules accumulate in the interfacial surface layer of a solid. The solid material is the sorbent, and the substance in the adsorbed state is called adsorbate. The basic principles and mechanisms involved in hemoadsorption include flow dynamics, chemical characteristics of synthetic materials, adsorption isotherms, mass transfer zone, and the Vroman effect. The development of devices and materials for hemoadsorption started in the 1970s, where activated charcoal coated in a plastic case was used as a sorbent for patients with drug overdose. Further developments of adsorbent materials led to the creation of several cartridges, which are now available for clinical use and are deployed for a myriad of purposes. Indications for hemoadsorption include sepsis, intoxication, drug overdose, acute kidney injury, rhabdomyolysis, cytokine release syndromes, acute liver failure, antibody-mediated autoimmune diseases, and uremia. Herein I describe in vitro and in vivo experiments related with hemoadsorption, specifically with cartridges containing polystyrene-divinylbenzene cartridges. The project comprises four in vitro experiments, of which three are already published, and two clinical trials, of which one is already published”.

“Skin hyperpigmentation can be characterized as a disorder in which there is excessive melanin deposition. The causes of hyperpigmentation are diverse and can range from patient stress to metabolic disorders and responses to skin trauma. During the stages of the melanogenesis process, tyrosinase acts as the main enzyme in the cascade of melanin production reactions, therefore, it can be considered an excellent target of pharmacological interest for the development of topical formulations. The production of medicines and cosmetics from medicinal plants and their extracts is a historical and current reality, with trees of the genus Morus being part of this context. Previously described studies in the literature demonstrated the inhibitory activity of the crude ethanolic extract of their leaves against the enzyme tyrosinase; however, to date, there are no studies regarding the potential of the extract after chlorophyll removal and incorporation into formulations. Therefore, this project aimed to produce, characterize, and formulate a cosmetic from the hydroalcoholic extract obtained from the leaves of Morus nigra L. The collected plant material was oven-dried at 40°C for 5 days, pulverized, and characterized by weight/particle size and moisture content. It was then subjected to ethanolic extraction by cold maceration (1:5 m/v), filtered, and rotary evaporated. To remove chlorophyll, the extract was resuspended in a methanol/water hydroalcoholic solution (1:1 v/v), followed by centrifugation at 4°C at 10,000 rpm for 10 min. The supernatant was collected, rotary evaporated again, and lyophilized. A total of six batches of extract were produced. The extracts were characterized by total solids content, extractive yield, thin-layer chromatography, and high-performance liquid chromatography associated with a diode array detector. The extract's inhibition potential against the enzyme tyrosinase and its cytotoxic effect on three cell lines: mouse fibroblast L929, murine melanoma B16F10, and human keratinocyte HaCat were evaluated. Two formulations containing the extract were also produced: a nanoemulsion and a serum. Both formulations were characterized by pH, viscosity, particle size, polydispersity index, zeta potential, and conductivity. They are currently being evaluated in an accelerated stability assay. Tyrosinase inhibition was above 90% for all extract batches at concentrations above 20 µg/mL; the overall average IC50 for the crude batches was 9.79 µg/mL and 10.81 µg/mL for the clean batches. The IC50 values for the extract's cytotoxicity on the three cell lines tested were all above 100 µg/mL. After six months of preparation, the formulations maintained their properties with little change and continue to be monitored in stability tests.”

“Introduction: Narrative Bioethics is configured as an effective approach to address conflicts, enabling individuals to interact with and influence the social environment in a more conscious and reflective manner. In Human Rights education, it stands out by fostering the understanding of human experiences in their complexity and broadening the debate on fairer and more inclusive health practices. In this context, photography, associated with Narrative Bioethics, emerges as a powerful tool to share experiences that reflect culture, tradition, and values. Likewise, film-debate, by articulating audiovisual language and critical dialogue, enhances ethical awareness and collective reflection, stimulating critical thinking and the construction of shared narratives. Objective: To develop and validate a participatory teaching methodology based on Narrative Bioethics, integrating photography and film-debate as pedagogical tools for the teaching-learning process of human rights in health education. Methodology: A qualitative social study structured in three stages: exploratory phase, with a pilot photographic workshop; fieldwork conducted in three undergraduate nursing classes, with pedagogical workshops combining photography, film-debate, and mapping of human rights violations; and analysis of empirical and documentary material. Narrative and iconographic analysis, pre- and post-workshop questionnaires, and content analysis were employed. Results: The research produced four articles that highlighted the potential of multiple narratives as formative strategies; the narrative and iconographic analysis of photographic productions as a didactic resource; the mapping of human rights violations in the Federal District; and the validation of filmdebate as an active methodology in human rights education. Discussion: The findings show that photography and film-debate broadened students’ awareness of ethical, social, and political issues, fostering critical consciousness for health practice. The workshops created spaces for dialogue in which students not only recognized but also re-signified human rights violations based on their own experiences, strengthening empathy and deliberative capacity. Narrative and iconographic analysis revealed the unique pedagogical role of art in articulating reason and emotion, thereby deepening the understanding of contexts of vulnerability. Active methodologies fostered student autonomy, encouraged participation, and promoted shared knowledge construction. Thus, Narrative Bioethics was consolidated as a critical pathway for teaching and learning—both formative and emancipatory. Conclusion: The study reinforces the relevance of integrating Narrative Bioethics and Human Rights into health curricula through innovative active methodologies. Photography and film-debate proved to be not only strategies for ethical sensitization but also means of empowering future professionals to recognize and confront injustice, exclusion, and violence. As a practical contribution, the thesis offers a pedagogical model replicable in different educational contexts, fostering interdisciplinarity and dialogue between bioethics, education, and human rights. From a theoretical standpoint, it reaffirms the centrality of narrative and art in critical and reflective health education. As a limitation, it acknowledges the need for longer follow-up of workshops to consolidate learning and assess medium- and long-term impacts. Nevertheless, the study opens pathways for future research and interventions that integrate art, ethics, and pedagogy, contributing to the consolidation of a more humanized, just, and dignity-oriented practice in healthcare.”

Introduction. Traumatic brain injury (TBI) is associated with a potential risk of triggering anatomical and/or functional alterations in various brain structures. Among the possible consequences of moderate to severe TBI is hypothalamic-pituitary dysfunction, which can be transient or permanent and manifest itself in the short, medium, or long term. We found no studies in the literature evaluating the impact of TBI on pituitary morphology over time in the post-trauma period.

Objectives. To carry out a longitudinal study of pituitary morphology (dimensions of its axes and volume) in children and adolescents who suffered a TBI and were followed up at the SARAH Network of Rehabilitation Hospitals; to recognize the frequency of structural pituitary lesions identified in this group; to assess whether there is a correlation between age at the time of the trauma and the sex of the patient with the pattern of changes in pituitary morphology over the years after the TBI. Methods. This is a retrospective longitudinal study of a cohort of children and adolescents who suffered a TBI before the age of 16 years and 11 months, treated in the Post-TBI Neurorehabilitation Program at the SARAH Brasília Unit and the SARAH International Neuroscience and Rehabilitation Center, Brasília (DF). Magnetic Resonance Imaging (MRI) scans of the brain/pituitary gland of children and adolescents, carried out between 2009 and 2021, were analyzed. The three pituitary dimensions (coronal height, coronal width, and sagittal width) and the respective volumes of the glands were obtained by analyzing the images in midsagittal and coronal views and performed by the same trained observer. The patients were grouped according to gender and the time after the stroke in which the MRIs were performed into: group 1 (G1: images taken during the first year after the stroke), group 2 (G2: images taken between 1 and £ 2 years after the stroke), group 3 (G3: images taken between 2 and £ 3 years post-CT), group 4 (G4: images taken between 3 and £ 4 years postCT), group 5 (images taken between 4 and £ 5 years post-CT) and group 6 (G6: images taken more than 5 years post-CT). The patients' pituitary dimensions and volumes were analyzed, and correlated according to the clinical variables gender, age at which the TBI occurred and time post-TBI. Results. A total of 78 patients were assessed, with a higher proportion of male TBI victims (n = 47, p = 0.01). The median age of the total group at the time of the TBI was 5.8 years (range 0.2 to 13.7 years), with no difference between the sexes (p=0.749). 152 pituitary MRI images were analyzed, with some patients having more than one sequential image analyzed. The time between the TBI and the pituitary MRI ranged from 0.1 to 15.8 years, with the following distribution: G1: n = 41, median 0.5 years; G2: n = 28, median 1.6 years; G3: n = 16, median 2.5 years; G4: n = 18, median 3.8 years; G4: n = 16, median 4.6 years; G6: n = 33, median 8 years. Alterations in pituitary morphology (decreased pituitary volume) were found in 23% of the images, corresponding to 32% of the patients (72% female), all of which corresponded to severe TBI, with no difference between the sexes. A U-shaped curve was observed when assessing the behavior of pituitary volume over time after TBI. The data showed a progressive decrease in the median of these values from the first to the third year after TBI, followed by a progressive increase from that point onwards (p = 0.00033). The pituitary dimensions coronal height and coronal width also behaved similarly to the volume over time after the TBI (p = 0.00004 and p = 0.0.00003, respectively). There was no correlation between age at TBI and severity of impairment of pituitary morphology over the post-TBI period. Conclusion. In the group under this study, there was a higher proportion of male TBI victims. There was no difference in age at TBI in relation to gender. Around a third of the patients showed changes in pituitary morphology over the follow-up period. The total group showed a nadir in pituitary volume between 2 and 4 years post-TBI, followed by recovery. There was no influence of gender or age at TBI on the evolution of pituitary morphology over the years after TBI.

Brazil is one of the countries that consumes the most pesticides in the world. Exposure to these compounds can generate disorders in endocrine metabolism, known as endocrine disruptors. Recent studies point to evidence that exposure to these substances may be associated with obesity and other metabolic disorders. Previous and not yet published studies from the research group I am part of demonstrate that some pesticides can promote lipid accumulation in cell cultures of 3T3-L1 cells, including ametrine, a compound belonging to the triazine group. Considering the high consumption of pesticides in Brazil and few studies regarding their deregulatory effects, this present study aimed to study the adipogenic potential of two compounds, simazine and promethrin, belonging to the same group as ametrine. To evaluate the adipogenic potential of pesticides, a cell differentiation assay was performed on 3T3-L1 cells. In this assay, 3T3-L1 cells were treated for 14 days with vehicle (DMSO), rosiglitazone or increasing concentrations of pesticides that promoted lipid accumulation. Considering that pesticides promoted lipid accumulation, a transfection and luciferase reporter gene assay was performed to evaluate the transcriptional effects of the compounds on the PPARγ and RXRα nuclear receptors. For this, HeLa cells were co-transfected with plasmids containing DNA complementary to the receptor and plasmids with their responsive elements fused to the luciferase reporter gene and treated for 24 hours with vehicle (DMSO), known agonists of the receptors under study or increasing concentrations of the pesticide simazine. and promethrin, it was observed that the pesticides under study did not present an agonist effect on the receptors evaluated. Considering that both simazine and promethrin promoted lipid accumulation in 3T3-L1 cells, an assay was performed to evaluate whether this effect is dependent on PPARγ. To this end, a cell differentiation assay was performed on 3T3-L1 cells, treated for 14 days in the presence or absence of the specific PPARγ antagonist T0090709, vehicle (DMSO), rosiglitazone or increasing concentrations of the pesticides simazine and promethrin. In this assay, a significant reduction in lipid accumulation was observed in cells treated in the presence of the PPARγ antagonist T0090709 in both pesticides, which suggests that the lipid accumulation promoted by the pesticides simazine and promethrin are dependent on the PPARγ receptor. The results obtained in this study can help to better understand the effects of these compounds on human and animal health. As well as generating incentives for research into more efficient compounds with fewer negative effects. However, more studies are needed.

Ibrutinib (IBR) is a tyrosine kinase inhibitor under investigation in pre-clinical and clinical settings as an alternative treatment for melanoma. Nevertheless, the limited oral bioavailability of IBR and the need for high doses of the drug to kill melanoma cells are major draw-backs for this purpose. Considering that melanoma is restricted to the skin at early stages, the topical application of IBR might constitute an effective and safer administration route. In this study, we determined the IBR toxicity and dermatokinetics using human primary cells and human organotypic skin explant cultures (hOSEC). After demonstrating that human primary fibroblasts and keratinocytes present IBR target genes, the cytotoxicity of the drug was determined using the MTT and annexin V/PI staining assays. IBR toxicity in the skin was assessed using the TTC assay, and the irritation potential was established using histological assessment. Finally, IBR cutaneous permeation was assessed ex vivo to determine the drug dermatokinetics. Our findings reveal that IBR exerts dose-dependent toxicity towards skin cells, keratinocytes presenting IC50 at the same range as melanoma cells. The topical application of the drug successfully reduced irritation and toxicity in the skin, and the drug was shown to successfully permeate the stratum corneum and reach the viable skin layers in therapeutic concentrations. Overall, our data encourages the topical application of IBR to treat melanoma, paving the way for future studies in the theme.

The introduction of bioceramic-based materials in endodontics was of great importance. Bioceramic sealers help to bury microorganisms by sealing the dentinal tubules and isolate the communication between the root canal and the periradicular space. Furthermore, these materials demonstrate bioactivity in periradicular tissues. Thus, this study evaluated the potential of extracts of the bioceramic sealers bioc sealer and bio-c sealer ion + in comparison with the ah plus sealer, in primary culture of human periodontal ligament cells (hpdlscs). Initially, the antimicrobial activity of the sealer extracts was verified by evaluating the minimum inhibitory concentration for the growth of enterococcus faecalis and candida albicans. Subsequently, the toxicity of the sealer extracts was verified in culture of hpdlscs by the mtt assay. Next, the proliferative and migratory effects of these sealers were evaluated by the scratch assay in hpdlsc cultures. Finally, the effect of the sealers on gene expression by pcr was evaluated, as were the pro-inflammatory cytokines tumor necrosis factor alpha (tnf-α), interleukin IL-1β and IL-6, and the regulatory cytokine IL-10, in different experimental situations. Results demonstrated that ah plus and bioc sealer ion + inhibited 100% of the growth of e. Faecalis in the presence ofextracts (1:1, 1:2 and 1:4). However, only the 1:1 extracts of ah plus, bio-c sealer and bio-c sealer ion + inhibited 100% of the growth of c. Albicans. The toxicity of the cements was demonstrated in a dose-dependent manner in hpdlsc cultures, so that the lowest viability percentages were observed in the presence of the extracts of ah plus (1:1; 55%), bio-c sealer (1:1; 69%) and bio-c sealer ion + (1:1; 72%). In the scratch assay, it was observed that the extract of the bio-c sealer ion + cement (1:4) allowed the highest rate of cell migration and proliferation after 48h, comparedto the data of the ah plus and bio-c sealer cements. Finally, it was observed that ah plus up-regulated the gene expression of the cytokines tnf-α, IL-6 and IL-10 in all conditions tested in vitro. Conversely, the bio-csealer and bio-c sealer ion + cements did not affect the gene expression of tnf-α, IL-6 and IL-10 in all conditions. Ah plus also increased IL-1β gene expression compared to bio-c sealer under lps and ifn-γ-stimulated conditions. Thus, it is concluded that bioceramic sealers showed satisfactory antimicrobial activity in the most concentrated extractsagainst e. Faecalis and c. Albicans, with moderate toxicity. In addition, bioceramic sealers allowed wound closure in vitro and maintained inflammatory and anti-inflammatory cytokines at basal levels. Given these results, accidental periapical extravasation of bioceramic-basedsealers does not appear to have negative consequences for periradicular repair”.

Heart Failure (HF), a complex clinical syndrome with high morbidity and mortality, is an increasingly expensive public health concern. The incorporation of new technologies in its treatment represents a challenge for the health systems of middle-income countries such as Brazil. Recently, a new class of antidiabetic agents - the sodium-glucose cotransporter 2 inhibitors (SGLT2i) - was associated with a significant reduction on mortality and hospitalization in HF with reduced ejection fraction (HFrEF) when added to standard pharmacological treatment. However, there is little data on its cost-effectiveness use in our country. The present study aims to evaluate the cost-utility of add-on dapagliflozin treatment for HFrEF, from the Brazilian public healthcare system (SUS) perspective. We developed a Markov model, based on the Dapagliflozin and Prevention of Adverse Outcomes in Heart Failure (DAPA-HF) trial, to assess the clinical outcomes and costs of 1,000 hypothetical subjects with established heart failure and reduced ejection fraction. Data regarding treatment costs, rate of readmission and all-cause death were based on Brazilian population. The main outcome was the incremental cost-effectiveness ratio (ICER) per quality-adjusted life-year (QALY) gained. Deterministic and probabilistic sensitivity analyses, as well as scenario analyses, were performed. Over a lifetime horizon, in Brazil the addition of dapagliflozin to standard care treatment in HFrEF patients yielded a mean of 0.37 additional QALYs at an incremental cost of US$ 960.92, resulting in an ICER of US$ 2,630 per QALY gained. In probabilistic sensitivity analyses, 99.51% of the simulations were cost-effective considering the Brazilian willingness-to-pay of US$ 8,000 per QALY gained. Results were similar for individuals with and without diabetes. Dapagliflozin is likely to be cost-effective when added to standard HFrEF therapy in Brazil.

Osteoradionecrosis (ORN) is a complication of radiotherapy for head and neck tumors, characterized by pain, infection, and deterioration in quality of life. Although Low-Level Laser Therapy (LLLT) and antimicrobial photodynamic therapy (aPDT) have shown efficacy in treating ORN by accelerating healing and controlling inflammation, there are still no standardized protocols for their use. The lack of clear treatment parameters prevents definitive conclusions about their clinical effectiveness. This scoping review explored current trends and available evidence on LLLT in the management and prevention of osteoradionecrosis, highlighting gaps in current research. The search strategy was conducted in MEDLINE/PubMed, EMBASE, Web of Science, and grey literature on January 15, 2024, without language or time restrictions. In total, 19 studies were included. The application of LLLT protocols was 58% for therapeutic use, 21% for preventive use, and 21% for a combination of both. Regarding the use of antimicrobial photodynamic therapy (aPDT), 41% of the studies employed this technique, which utilized methylene blue as the photosensitizer. For treatments associated with photobiomodulation, 57% reported pharmacological treatment, 29% surgical treatment, 11% prescribed chlorhexidine mouthwashes, and 4% other therapies. In vivo studies used diode lasers emitting low incident power densities in the near-infrared wavelength (67%) at 780 to 904 nm. In comparison, case reports also used diode lasers emitting low incident power densities in the red and near-infrared wavelength (64%) at 660 to 904 nm. The continuous emission mode was utilized in 83% of in vivo studies and 17% of the case reports. None of the studies included in this review reported all laser parameters. LLLT shows promise for therapeutic and preventive purposes. However, incomplete data on laser parameters makes it difficult to establish standardized treatment protocols. The studies exhibited significant heterogeneity in study design, laser parameters, administration protocols, and interventions in the control groups. Therefore, more studies with homogeneous methodologies are needed to enhance and evaluate the effectiveness of the LLLT in osteoradionecrosis.

Major depressive disorder (MDD) affects over 300 million people globally and has a multifactorial etiology. The  CYP2C19 enzyme, involved in metabolizing certain antidepressants, can influence treatment response. Following the PRISMA protocol and PECOS strategy, this systematic review assessed the variation in common CYP2C19 gene variants' frequencies across populations with MDD, evaluating their impact on clinical characteristics and treatment response. We comprehensively searched five databases, identifying 240 articles, of which only nine met our inclusion criteria within the last decade. Except for one study that achieved 74.28% of STROPS items, the rest met at least 75% of GRIPS and STROPS guidelines for quality and bias risk assessment. The CYP2C19's *1 allele, the *1/*1 genotype, and the NM phenotype, considered as references, were generally more frequent. Other CYP2C19 polymorphism frequencies exhibit significant variability across different populations. Some studies associated variants with MDD development, a more extended history of depression, prolonged depressive episodes, and symptom severity, while others reported no such association. Some studies confirmed variants' effects on escitalopram and citalopram metabolism but not that of other drugs, such as sertraline, venlafaxine, and bupropion. Treatment tolerability and symptom improvement also varied between studies. Despite some common findings, inconsistencies highlight the need for further research to clarify the role of these polymorphisms in MDD and optimize treatment strategies.

“Introduction: The COVID-19 outbreak quickly became a pandemic. In Brazil alone, over 7 million cases were recorded in 2020. Most patients affected by the disease were hospitalized in intensive care units (ICU), requiring qualitative polypharmacy, a scenario that increases the risk of serious cardiovascular adverse drug reactions (ADRs) such as QT interval prolongation, torsades de pointes, and serotonin syndrome. Objectives: The aim of the article was to identify cardiovascular ADRs due to medication use in the ICU of the Regional Hospital of Asa Norte (HRAN) in Brasília, Federal District, through the analysis of medical records of COVID-19 patients hospitalized in 2020. Methodology: The analysis of patient prescriptions was based on the Tisdale score, utilizing innovative software and hypothetical substitutions of medications derived from this assessment. Results: A significant reduction in serious ADRs, with a 53% decrease in the Tisdale score, was achieved following the proposed medication substitutions. Additionally, there was a 30% reduction in the use of medications associated with potential serious cardiovascular ADRs that could cause synergistic serious cardiovascular ADRs. Conclusion: The medical emergency of COVID-19 highlighted the need for swift actions in the pharmacological management of ICU patients. Thus, the use of technologies to assist healthcare professionals can be decisive for patient survival.”

The study deals with the monitoring and evaluation process in distance learning courses on arboviruses aimed at primary school teachers. Considering health education and communication as crucial in the prevention and control of arboviruses, dengue, zika and chikungunya, the course used these contents and methodologies capable of strengthening the relationship between health and education, turning basic education schools into teaching environments that propagate knowledge and practices for the control and prevention of arboviruses. The qualitative and quantitative methodologies described and analyzed 119 questionnaires applied to graduates from June to August 2021, in four dimensions. The results highlight the assertiveness of the choice of content, methodologies and use of technologies as facilitators for continuing health education.

The periodontal condition of pregnant women has been the focus of several studies carried out in Periodontal Medicine, due to some scientific evidence that points to a probable association between periodontitis and gestational outcomes. However, there is still no consensus for the diagnosis of periodontitis, making the reliability and comparability of epidemiological studies difficult. OBJECTIVE: To assess the accuracy of diagnostic criteria for periodontitis in pregnant women. METHOD: Had two parts. In the first one, a Systematic Review was carried out with studies of the accuracy of the different criteria for the diagnosis of periodontitis in pregnant women. Indexed articles that met the eligibility criteria in the main health literature databases were selected. The descriptors used in the search strategies were pregnant women, data accuracy, sensitivity, specificity, and validation studies. There was no language or publication date limitation. Verification of the existence bias inherent to the accuracy studies and assessment of the quality of evidence were performed. The second part comprised a validation study carried out with pregnant women who underwent prenatal care and sought care at three public hospitals in northeastern states: Bahia and Pernambuco. Participants were classified according to the presence and severity of periodontitis, according to proposed criteria, namely: 1) Page and Eke, 2007/2012, 2) Gomes-Filho et al., 2018, 3) Albandar et al., 2007, 4) Bassani et al., 2007, 5) López et al., 2002 and 6) Nesse et al., 2008. Taking the following criterion as the gold standard: 1) Gomes-Filho et al, 2018. Comparing the others criteria the diagnostic values were estimated: sensitivity, specificity, predictive values, likelihood ratio and their respective confidence intervals. RESULTS: They are presented in the form of 2 articles: 2) Systematic review, which included 4 articles and concluded that there is no standardization regarding the criteria used for the clinical diagnosis of periodontitis in pregnant women, with a wide variation in the prevalence of the disease according to each criterion adopted. 2) Original research article entitled “Different criteria for the clinical diagnosis of periodontitis in pregnant women: a validation study” with 1251 pregnant women. The results identified diagnostic criteria that can be recommended for screening and diagnosis of the disease, which should be chosen according to the research objectives and the characteristics of the population. CONCLUSIONS: In view of the panorama surrounding the specific characteristics of maternal periodontitis and the nonconsensual criteria existing in the literature for the diagnosis of this disease, the importance of standardizing the methods of diagnosing the disease is ratified, to contribute to the implementation of measures focused on the health of the pregnant woman and, therefore, of the newborn.

Aguardando formulário editável

Acute periapical abscesses can progress and trigger complications such as airway compromise, septicemia, and even death. Thus, this thesis evaluated the systemic and local conditions of patients diagnosed with acute periapical abscess, followed by assessment of microbial patterns. This was classified as a cross-sectional observational study involving patients admitted to the emergency service of the Instituto Hospital de Base do Distrito Federal (IHBASE), during one-year period. A total of 305 individuals with an initial diagnosis of odontogenic infection in 2019 were evaluated. Of these, 16% (50 individuals) were diagnosed with acute periapical abscess and for further analysis were divided into four groups: (G1) patients who accessed IHBASE without antibiotic use and without local intervention; (G2) patients who accessed IHBASE with antibiotic use, without local intervention; (G3) patients who accessed IHBASE with antibiotic use, without local intervention, and required hospitalization for 7 days or less; and (G4) patients who accessed IHBASE with antibiotic use, without local intervention, and required hospitalization for more than 7 days. Clinical and serum data (via complete blood count) were collected from IHBASE electronic records. Analysis of local immune response was performed by qPCR to assess pro-inflammatory (IL-1β, IL-6) and antiinflammatory (IL-10) mediators. Subsequently, genetic sequencing of 16S V3-V4 and ITS1 genes was performed in paired-end 2x250 bp (PE250) mode and run on the MiSeq Illumina platform, pipeline- RefSeq: NCBI. The results showed that patients in groups G2, G3, and G4 had a higher percentage of severe symptoms and a more advanced infectious process compared to patients in group G1. Increases in leukocyte and neutrophil counts were observed in the blood counts of patients in groups G3 and G4 compared to group G1 (p≤0.05). No differences were observed in the local expression of pro- and anti-inflammatory mediators among the sample groups. 16S gene sequencing revealed a total of 780 bacterial genera identified, mainly represented by Prevotella (54.5%). ITS gene sequencing resulted in the identification of 12 fungal genera, led by Talaromyces (42.5%). This study demonstrated the complexity of the evolution and emergency treatment of acute periapical abscesses, with polymicrobial etiology and significant clinical progressions, allowing reflections on the emergency management of acute periapical abscesses conditions and their potential repercussions.

Introduction: Deep brain stimulation (DBS) of brain nuclei is an effective symptomatic therapeutic strategy for the treatment of Parkinson's disease (PD). Unlike humans, there is evidence of neuroprotection mediated by DBS in rodents where parkinsonism was experimentally triggered, but in protocols conducted outside the acute phase of the disease induction. Objectives: To study neuroprotection as well as motor responses induced by DBS in the acute phase of parkinsonism induction through intrastriatal injection of the neurotoxin 6-hydroxydopamine (6-OHDA) in mice. Materials and Methods: Three experimental groups were defined. The first two groups received interventions only on the left side of the brain, preserving the right side for control. One group underwent a nigrostriatal lesion and had an activated intracerebral DBS electrode implanted to neuromodulate the left Subthalamic Nucleus (STN) (6-OHDA + DBS) (n=6); another had a nigrostriatal lesion and an inactive DBS electrode implanted in the same location (6-OHDA) (n=8); and the remaining group was Naive (n=5). The interventions were performed on day zero (D0). During the first four days after the procedure (D1 to D4), behavioral assessments and the measurement of electrical resistance of the brain-electrode system in the 6-OHDA + DBS group were carried out. Body mass was measured in the animals from D1 to D4 as well as on D7, just before euthanasia for collection and subsequent analysis of the animals' brains. After Nissl staining of the STN region, animals with inaccurately located electrodes were discarded. An immunohistochemical study was carried out with Tyrosine Hydroxylase (TH) staining in the sections of the Substantia Nigra (SN) and the striatum to quantify the difference in the number of nigral dopaminergic neurons as well as the density of striatal dopaminergic terminals between lesioned and intact side Results: When comparing parkinsonian animals, those that underwent DBS regained body mass and exhibited improved performance in behavioral tests. While there was a trend towards a reduction in electrical resistance of the brain-electrode system, it was not statistically significant. More TH+ cells were identified in the SN ipsilateral to the lesioned side, particularly in the central and lateral regions. Additionally, a higher optical density of TH staining was observed in the lesioned striatum sections of the animals that received DBS. Conclusion: Despite the deteriorated clinical condition of the animals in the acute post-parkinsonism induction phase, the presented data show a body mass gain, favorable motor effect, reduced loss of striatal dopaminergic terminals, as well as a compartmentalized neuroprotective effect in the STN of mice that received four days of DBS, initiated one day after the induction of parkinsonism by 6-OHDA, compared to those that did not receive it. In the current context of seeking diagnosis of PD in premotor stages, the findings contribute to enriching the discussion on neuroprotective therapeutic strategies, proposing invasive neuromodulation as a potential therapeutic approach in an appropriate context.

Osteogenesis Imperfecta (OI) is a heterogeneous connective tissue disorder, most caused by pathogenic variants in genes encoding type I collagen. Clinically, OI is classified into four subtypes based on severity, and genetically, it has 22 subtypes depending on the gene harboring the causative variant. Among patients with OI seen at the Center for Rare Diseases Dental Care, 14 have not received a molecular diagnosis, which is essential for proper genetic counseling. The primary objective of this study was to identify causative variants in these OI patients. Exome sequencing was performed, and in 12 out of 14 patients, pathogenic variants were identified as heterozygosity in COL1A1 and COL1A2 genes, and homozygosity in P3H1, CRTAP and SERPINF1 genes. Five of the identified variants had not been previously reported in the literature. The main signs and symptoms include bone fragility and variable growth delay among individuals. Various craniofacial and dental manifestations have been described, including characteristic facial features and Dentinogenesis Imperfecta. Tooth agenesis (TA) occurs frequently in individuals with OI, although its etiology remains unclear. Some authors propose that TA may be a manifestation of OI, while others consider it a concurrent condition. The secondary objective was to identify causative variants associated with TA in genes expressed during dental development in OI patients. Samples from patients with both TA and OI who had undergone exome sequencing were analyzed. No genetic variants specifically causing TA were identified in the studied genes, suggesting that TA is indeed a manifestation of OI. Several studies have explored the relationship between the high frequency of dental anomalies in OI patients and treatment with antiresorptive treatment. Besides TA, taurodontia and delayed tooth eruption are other anomalies frequently observed in OI patients. The third objective was to assess the frequency of dental anomalies in clinically diagnosed OI patients. Panoramic radiographs of OI patients were compared with those of age- and sex-matched individuals without OI. TA was significantly more frequent in OI patients compared to non-OI individuals (p<0.05), especially in severe cases. Other dental anomalies did not show significant differences, more studies with larger samples are needed. Finally, the fourth objective was to investigate the association between TA frequency in OI patients, intravenous pamidronate treatment onset, and the number of doses administered. No significant difference was found between the groups (p>0.05), indicating that TA is not associated with pamidronate treatment in our patients.

Parkinson's disease (PD) is a neurodegenerative pathology with enormous social and psychological losses in the lives of those affected. The causes of the onset of the disease still remain unclear, as the disease has multifactorial components. The main pathophysiological characteristics of the disease are the degeneration of dopaminergic neurons in the Basal Nuclei, especially the Substantia Nigra (SN) and the presence of eosinophilic inclusion bodies in the cytoplasm of neurons, known as Lewy bodies. The absence of approved medicines in humans capable of altering the evolution of the disease, in addition to the adverse effects associated with existing conventional treatments, results in an urgency in the development of new strategies to study the disease and more effective treatments that make it possible to modify the course of the pathology. The present work aimed to evaluate the neuroprotective activity of the synthetic peptide Neurovespina (an analogue of the peptide isolated from social wasps) in its free form and associated with nanotechnology, in the murine model of Parkinson's Disease by unilateral intrastriatal injection of the neurotoxin 6-OHDA. 3 test days were used to evaluate, two administrations per day of the free peptide (or one per day associated with nanotechnology) for 7 days, the effects of the free peptide and associated with nanotechnology. The assessment of motor impairment was measured using the RotaRod equipment using fall latency, showing a statistical difference between the Sham and Injury Control (6-OHDA) groups. The cylinder test was performed to evaluate the asymmetry of the forelimbs during the exploration task and showed no statistically significant difference between the groups. The neuron count revealed a statistically significant difference (between the injured side and the healthy side) in the nanoneuro and injury control groups. In the analysis of remaining THr neurons (percentage in relation to the contralateral side) in the SN, only the Neurovespina group did not show a statistically significant difference when compared with the Sham group. Inspection of striatal Optical Density demonstrated a statistically significant difference (between healthy and injured sides) in all treatment groups with the exception of the Sham group. The results of this work indicate and corroborate the neuroprotective action of the synthetic peptide Neurovespin (in its free form) on SN dopaminergic neurons, after intrastriatal 6-OHDA injury, as a potential model drug for the development of new neuroactive molecules for the study of DP.

The use of medicinal plants has directed pharmaceutical research towards the development of new therapeutic options aimed at combating different pathologies. Psidium guajava L., a species belonging tropical countries, P. guajava is native to South America and has been widely used in folk medicine around the world since ancient times. Ethnopharmacological studies show that the species is used to treat a series of diseases such as gastrointestinal disorders, inflammatory processes, and dermatomucosal conditions, as a hypoglycemic agent and analgesic, among others. In Brazil, the species is mainly used to treat acute diarrhea or dysentery. In addition, there are old reports of its use in the treatment of inflammation of the mouth and throat. The aim of this study was to develop, characterize and evaluate polymeric microparticles containing aqueous extract of P. guajava L. leaves in order to assess their anti-inflammatory action against oral diseases, as well as the safety and stability of a pre-formulation for topical use. Different biological activities were evaluated, as well as the characterization of the extract (EAPG) and the developed microparticles. P. guajava leaves were collected, pulverized, equally divided into four batches and the standardized extract was obtained by infusion. All batches were within the limits recommended by Anvisa for total solids content, yield, moisture content, total polyphenol content reproducibility of the extraction process, also demonstrated by the chromatographic profile of TLC and HPLC-DAD. The chromatographic method employed using HPLC was validated and all parameters evaluated presented values within the acceptance criteria. Chitosan particles loaded with extract were developed based on a predictive response surface model, varying the concentration of the chitosan polymer and the sonication time during the addition of the crosslinking agent. The safety of EAPG and the particles were evaluated by performing cytotoxicity tests using the MTT method. Different biological activities were analyzed. The antioxidant activity of EAPG and the microparticles reducing activity and the iron reducing antioxidant power (FRAP) assay methods. The IC50 of the evaluated antioxidant activity ranged from 6.35 to 7.01 µg/mL for the of concentrations equivalent to 60 µM of Fe2+ were found, ranging from 14.42 to 17.83 µg/mL of the tested samples. Regarding anti-inflammatory activity, good results were obtained regarding the expression of IL-6, both of EAPG and of the developed particles. In the antimicrobial activity evaluation assays, EAPG was tested against different Candida species and presented MIC values of 16.24 mg/mL for C. albicans 90028; 12.25 mg/mL for C. albicans 40277; 6.99 mg/mL for C. famata 40135; 6.03 mg/mL for C. glabrata 40134; 8.15 mg/mL for C. guillermondii and; 7.52 mg/mL for C. krusei. No migratory activity of EAPG was obtained using primary fibroblast cell lines in the scratch test. The stability of the particles was evaluated and the best results were obtained in the sample stored in the refrigerator, when compared to that stored at room temperature. Finally, the in vitro skin permeation of EAPG was evaluated. Given all the results found, it can be suggested that the polymeric particles loaded with EAPG developed have potential for the topical treatment of oral conditions.

INTRODUCTION: Acute Lymphoblastic Leukemia (ALL) is the most common cancer in childhood, accounting for 30% of pediatric neoplasms. The peak incidence occurs between 2 and 5 years of age, with survival rates exceeding 90% in developed countries. In developing countries, survival rates are lower, attributed to limited access to healthcare and higher mortality from treatment-related toxicity. Even under optimal conditions, certain subgroups of B-ALL patients do not respond to treatment or experience relapse. Biological characterization has enabled the identification of new B-ALL subtypes and the development of novel therapeutic tools. In Brazil, leukemia assessment through molecular biology and genetic sequencing is restricted to a few research centers. Thus, there is a need to determine the biological subtypes of B-ALL and their clinical course at a Brazilian reference center. OBJECTIVES: To identify the biological subtypes of B-ALL, describe the frequency of these subtypes, and correlate them with clinical outcomes. METHODOLOGY: Patients aged 1 to 18 years, admitted to the HCB with a diagnosis of B-ALL between July 2018 and September 2023, were evaluated. Patients received treatment according to two protocols: modified BFM-ALLIC2009 (122 patients) and GBTLI2021 (34 patients). For biological characterization, bone marrow samples were evaluated by conventional cytogenetics, RT-PCR (ETV6::RUNX1, TCF3::PBX1, BCR::ABL1, rKMT2A, P2RY8::CRLF2), MLPA (IKZF1, PAX5, ERG, iAmp21), RFLP, capillary fragment analysis (FLT3 mutations), and Next-Generation Sequencing (NGS). The correlation between B-ALL biological subtypes and minimal residual disease (MRD) values, relapse occurrence, overall survival (OS), and event-free survival (EFS) rates was analyzed. RESULTS: A total of 156 patients were evaluated. OS rates were 100%, 86%, and 59% in patients treated with the adapted BFM-ALLIC2009 protocol and classified as low, intermediate, and high risk, respectively. The leading cause of death was infection associated with neutropenia. Fourteen B ALL subtypes were identified, encompassing 86% of patients. ETV6::RUNX1 ALL (26%) and high hyperdiploidy (19%) were the most common subtypes. Patients with IKZF1plus had lower OS (48%, p=0.04, Log-rank Mantel Cox Test), PAX5 alterations were associated with higher MRD levels on D33 (p=0.03, Mann-Whitney Test), higher relapse risk (Fisher's Exact Test, p=0.04), and lower survival (OS 33%, p=0.005, EFS 55.5%, p=0.01). FLT3 TKD mutation was associated with relapse (Fisher's Exact Test, p=0.04). Patients with P2RY8::CRLF2 did not show unfavorable outcomes. CONCLUSION: Survival rates are below those observed in international centers and could be improved by reducing treatment-related mortality. The divergent clinical outcomes in certain B-ALL subtypes underscore the importance of characterizing the biology and progression of B-ALL in Brazil. We identified the need to increase sample size and assess new markers, including genetic factors associated with greater susceptibility to chemotherapyrelated toxicity, which may explain the higher treatment-related mortality.

The enzyme L-asparaginase (L-ASNase) was the first therapeutic enzyme discovered and treats leukemia. Its mechanism of action consists of catalyzing the hydrolysis of L-asparagine into aspartic acid and ammonia. Despite being the first line of treatment for ALL, there is still no production of LASNase in Brazil. Furthermore, all approved and commercially available L-ASNase formulations are of bacterial origin (from native and pegylated Escherichia coli, and Dickeya dadantii); however, these formulations can cause toxicity and hypersensitivity in some patients. Aiming the production of an LASNase with fewer possible adverse effects and higher yield, this work investigates the L-ASNase from the fungus Penicillium sizovae, isolated from the soil of the Cerrado. Two approaches are evaluated: the native enzyme and the enzyme heterologously expressed in the prokaryotic system E. coli BL21(DE3). The production of the native enzyme is optimized considering low-cost conditions and less environmental impact. After screening the culture medium, extraction methods, and solvent used, purification was performed in a two-phase aqueous polymer/salt system, with the PEG2000/phosphate buffer system presenting the highest purification factor (1.63). Ion exchange chromatography was recovery yield up to 33.66%. The enzyme expressed in E. coli had its cloning and expression confirmed by PCR, SDS-PAGE, and Western Blot. The presence of the enzyme was observed mainly in the insoluble fractions, suggesting the formation of inclusion bodies (IC). To identify the best cultivation conditions in both the soluble and insoluble fractions, an expression optimization was performed considering inducer concentrations, post-induction time, and temperature. Still expressed in CI, solubilization tests were performed with guanidine hydrochloride, and then an experimental matrix to find the best additives for its refolding in the original conformation. The tetrahedral conformation was confirmed with native-PAGE; however, the enzyme did not have activity. New studies should be carried out to find the ideal condition for this recombinant L-ASNase present enzymatic activity.

Introduction: The novel coronavirus disease (COVID-19) was responsible for the increase mainly in the number of cases of hospitalized patients in a state of hypercoagulability and other hematological changes, having as a problem of deep vein thrombosis (DVT), in the intensive care unit (ICU). Objective: to present an analysis of the infectious process and incidence of Deep Vein Thrombosis in patients diagnosed with COVID-19, in addition to promoting criteria for early identification and detection of risks for clot formation. Methodology: this is a retrospective study carried out by analyzing the electronic medical records of 26 patients of patients with COVID-19 in the period between February and May 2021. patients with COVID19P and 10 patients with COVID-19 without the presence of DVT. Results: DVT was present in 61.54% of the patients evaluated with COVID-19, the age group ranged mainly between 40 and 59 years and males were prevalent in both groups. Regarding comorbidities, systemic arterial hypertension was present in 75% of patients who developed DVT, followed by obesity and diabetes mellitus. All patients evaluated in both groups had increased levels of CRP, ferritin and D-dimer. In the cogulogram, TAP and APTT showed alterations only in the group that corresponds to those who developed DVT. Conclusion: Thrombocytopenia was correlated with progression of COVID19 and development of DVT. The need for mechanical ventilation, the use of arterial and venous devices, the period of hospitalization, and the development of acute kidney injury requiring hemodialysis, demonstrated the impact that DVT has on hospitalized patients and its imminent increase in the risk of mortality when associated with COVID-19. Statistically, patients with COVID-19 associated with DVT are more likely to develop a severe clinical condition

Introduction: Health services have implemented major improvements for adherence to measures to prevent infections related to health care. Ventilator Associated Pneumonia (VAP) is among the most common infections in Intensive Care Units (ICU). Objective: To analyze the knowledge of health professionals about the Pneumonia Prevention Associated with Mechanical Ventilation bundle in the Adult Intensive Care Unit of a Teaching Hospital in the Federal District (DF). Method: quasiexperimental research of a quantitative nature. A questionnaire was applied to 93 ACU health professionals (physicians, nurses, physiotherapists, nursing technicians and dentists), with sociodemographic questions and about the items of the VAP prevention bundle, from August to October 2022. Results and Discussion: the overall average of correct answers was 74.6%. As for the level of education, it was identified that 62.4% of the participants had completed high school. With regard to training in continuing professional education, 81.7% of participants responded that they participated in events, lectures and courses; 92.5% of participants showed interest in receiving specific training on VAP; What they considered most important for improving learning in care about VAP prevention, 51.6% of health professionals answered permanent education; The difficulties indicated by health professionals to perform care on the prevention of VAP 39.8%, was the care in maintaining the position of the filter and trachea adequate; As for 19.4%, the most difficult thing is to perform the HO. Final considerations: Therefore, it is considered that bundles alone do not ensure the reduction of VAP rates, but should be implemented together with a group of actions with the same objective. Another point to be explored for other future studies is the financial impact of a bundle, to better demonstrate the institutional investment in VAP prevention.

In mid-2020, humanity faced one of the biggest pandemics in its entire history. The pandemic arising from the new coronavirus (COVID-19) has become one of the great challenges of the 21st century. It currently affects more than 100 countries and territories on five continents. Its impact remains invaluable, but directly and/or indirectly affects the health and economies of the world's population. It comprises of an infectious disease caused by the coronavirus related to severe acute respiratory syndrome through the SARS-CoV-2 virus. In 2019, in Wuhan, China, the first case of pneumonia caused by an unknown pathogen was described and reported to health authorities. On January 7, 2020, the first viral genome sequencing results were published and on January 12, China showed that the genetic sequences were shared with countries around the world and with the WHO through the Global Initiative on Sharing Database. All Influenza Data (GISAID). From these diagnoses, cases spread rapidly across the world, initially in mainland Asia, with cases reported in Thailand, Japan and South Korea. The virus was then imported to other countries and continents. Due to its high transmission power, Covid-19 promoted the development of scientific research aimed at studying efficient strategies to combat SARS-COV. In this sense, research has shown a very significant result of the effectiveness of microemulsions against a range of microorganisms, including bacteria, viruses, fungi and yeasts. Therefore, it is important to emphasize the great importance of microtechnology in the pharmaceutical, chemical and biological areas, making it possible to increase the bioavailability of therapeutic molecules, favoring interaction and biological potentiation. In this way, the present work aims to develop an innovative effervescent sanitizing device containing thymol particulate system, through the elaboration of a saponeic base through recycled oil and standardization, preparation of microemulsions, performance of DSC and Mev tests and elaboration of an innovative tablet of physical-chemical quality and microbiological and bacteriological efficiency. The method used in this work was analyzed using the High Performance Liquid Chromatography (HPLC) equipment, with the production of stock solutions in methanol, this solvent was used to enable the dilution of thymol because it is highly soluble in alcohol. Currently, a gap is noticeable regarding the presence of a specific literature regarding the tablet production process which was formulated in this work. Thus, the study was developed by carrying out tests which were chosen for better analysis of the formulations, taking into account the guidelines of the resolution of the collegiate board RDC n 59- 2010, which provides for the procedures and technical requirements of good practices for sanitizing products, the Brazilian Pharmacopoeia 6th Edition in the analyzes for tablets, as well as the scientific literature.

The present work was proposed to evaluate the viability of saliva as an alternative for detecting anti-SARS-CoV-2 antibodies. This work was divided into 2 studies. The first aims to evaluate the detection of anti-SARS-CoV-2 antibodies in saliva after vaccination using the rapid systematic review methodology. Fifteen studies were included, with approximately 1,080 saliva samples from vaccinated and/or convalescent individuals. Vaccines were mainly RNA-based, including recombinant viral vector vaccines as well. The techniques applied for the evaluation of salivary antibodies included ELISA assay, Multiplex Immunoassay, Flow Cytometry, Neutralization and Electrochemical assays. IgG, but not IgA, was frequently presented in saliva from vaccinated antiCOVID-19. Although antibody titers are lower in saliva than in serum, the results showed that saliva is suitable for antibody detection. The second study was of the longitudinal experimental type and aimed to evaluate the detection of anti-SARS-CoV-2 antibodies in the serum and saliva of vaccinated adults. 13 participants were included as a negative control and 35 participants vaccinated with two doses of the CoronaVac vaccine who subsequently received the Pfizer vaccine as a third dose. Vaccinated participants were evaluated after the second dose, one month and five months after the third dose, totaling 118 saliva samples. The ELISA assay was used to detect neutralizing antibodies (NAb), IgA and IgG. Also, electrochemiluminescence for detection of total antibodies (TAb) in 20 initial samples. TAb was detected in 10/10 samples in serum (158.13±88.1 U/mL) and only in 3/10 in saliva (0.63±0.46 U/mL) after the second dose. In serum, NAb was detected in 34/35 participants after the second dose (57.86±20.74%) and in 35/35 participants one month (95.6±3.34%) and five months (95.03 ±1.17%) after the third dose (p<0.0001). In saliva, NAb was detected in 30/35 samples after the second dose (6.54±5.54%), and in 35/35 samples one month (29.51±11.96%) and five months (10. 17±4.99%) after the third dose (p<0.0001). IgA was detected in 19/34 saliva samples after the second dose (1.46±1.01 ratio), 18/35 saliva samples one month after the third dose (1.71±1.65 ratio) and 30/35 five months after the third dose (2.69 ±1.72 ratio) (p<0.0013). IgG was detected in 1/34 saliva samples after the second dose (0.38±0.21 ratio), 33/35 saliva samples one month after the third dose (3.08±1.63 ratio) and 20 /35 saliva samples five months after the third dose (1.44±0.76 rare) (p<0.0001). There was a positive correlation between NAb and TAb in serum (r=0.6634), NAb in serum and IgG in saliva (r=0.7896), and NAb and IgG both in saliva (r=0.6115). Excellent sensitivity was observed for the salivary NAb test (95%). The salivary IgG test showed excellent sensitivity (100%) overall, excellent accuracy (100%) one month after the third dose, and still good accuracy (85%) five months after the third dose. NAb, IgA and IgG antibodies were found in the vaccinated saliva. In conclusion, studies have shown that anti-SARS-CoV-2 antibodies can be found in the saliva of individuals vaccinated for COVID-19.

Newborns in neonatal intensive care often require long periods of hospitalization and are subjected to several invasive therapeutic procedures, making them exposed to a number of adverse events. Quality improvement cycles have proven to be an important ally in preventing these events. Unplanned extubation (UE), understood as the accidental loss of the endotracheal tube (ETT) during mechanical ventilation or its exchange due to suspicion of obstruction or inadequate diameter, is considered the fourth most common adverse event in neonatal intensive care units (NICUs) in North America. Evidence on factors related to UE in neonatal intensive care and measures to prevent it are not well described in the literature. Thus, this study aimed to analyze the main intervention measures used in order to reduce UE in Neonatal Intensive Care Units. Thus, a systematic review of the literature was conducted. Original articles of randomized or nonrandomized clinical trial, quasi-experimental with control group, before-and-after without control group and interrupted time series types, which presented measures targeted at unplanned extubation prevention and whose outcomes were measured before-andafter intervention were searched in the following databases/journal portals: United States National Library of Medicine and National Institutes of Health (PubMed), Excerpta Medica (EMBASE), Scopus, Cumulative Index to Nursing and Allied Health Literature (CINAHL), Cochrane Library, Scientific Electronic Library Online (Scielo), Latin American Literature in Health Sciences (LILACS). Four reviewers, in a paired and independent manner, selected and evaluated the papers, and in case of disagreements, a fifth reviewer was consulted. The adopted search strategy retrieved 8,616 papers, of which 17 met the predetermined inclusion criteria. All included studies were before-and-after studies with no control group and interrupted time series. The main interventions directed at reducing UE were: presence of two or more clinical professionals while performing care or procedures on intubated patients; standardization and routine evaluation of ETT positioning; standardization of the ETT fixation model and routine evaluation of its integrity; documentation and review of all UE; signaling to increase team engagement or serve as a warning to intensify surveillance. The risk of bias of the selected studies was independently assessed by three reviewers using the NHI Assessment Tool for Before and After Studies, who pointed out a low methodological quality of the studies, mainly related to a lack of clarity regarding the eligibility criteria of participants, sample size, and statistical methods used. A positive relationship was identified between the adoption of intervention strategies and the reduction of UE, but more robust studies with more robust methodological quality are still needed to better determine the causal relationship of the outcomes with the interventions adopted.

Brain temperature variations are present in different neurophysiological functions and accompany pharmacological effects. One possible mechanism is changes in neurovascular coupling, which is the close relationship between neuronal activity and blood vessel volume with consequent variation in brain temperature. Ketamine (KET) and MK-801 (dizocilpine) are non-competitive glutamatergic NMDA receptor blockers. Both drugs produce similar electrophysiological effects, but with some marked differences, which may reflect differences in the mechanisms of action of these compounds. It is possible that the physiological and behavioral changes induced by NMDA channel blockers do not exclusively result from the pharmacodynamic interaction of these receptors, but depend on the correlated effects of brain temperature variation, correlates of brain electrical activity and cardiac function. In this study, we evaluated the physiological changes (intracerebral temperature, neural oscillations and cardiac activity) induced by these two drugs in rats anesthetized with isoflurane. Ten Wistar rats were used for analysis of temperature variation and cerebral oscillations, as well as cardiac function after acute administration of ketamine (30 mg/kg; n=5) and MK-801 (0.1 mg/kg; n= 5). The entire acquisition was performed after stereotaxic surgery for the insertion of a deep electrode in the CA1 region of the hippocampus together with the temperature sensor. A screw in the subdural region contralateral to the electrode was positioned for acquisition of the most superficial activity, and one in the cerebellum was used as a reference. A system (equipment and computer program) for measuring temperature in biomedical experiments was developed in the present work, as well as its validation in in vivo experiments. In addition to the apparatus, a protocol for acute measurement of temperature and brain electrical activity along with cardiac activity was established in the laboratory. From the acquisitions it was possible to observe that the brain temperature in anesthetized rats is lower than the body temperature, which is different in awake larger mammals. As well as corroborating with previous studies that brain temperature suffers small fluctuations when compared to body temperature, which is more homogeneous over time. It was confirmed that NMDA antagonists have a great influence on the dynamicity of brain rhythms and their administration in both cases decreased the animals' beats per minute. Finally, the acquisition approach of three physiological variables proved to be a metric with greater possibility of analysis at the systemic level of how drugs such as ketamine and MK-801 act.

Introduction: Recently, a new "metabolic classification" was proposed for prolactin, and based on it, hypoprolactinemia and hyperprolactinemia were defined as results approximately < 7 and > 100 ng/mL, respectively. Various metabolic diseases have been associated with this range of results, however, the determination of the cut-off points that influence metabolism seem uncertain. Objectives: To investigate the possible correlation between prolactin concentration and glucose and lipid metabolism tests. To establish a "gray zone" that represents the inflection points, associating the results of the glycemic and lipid metabolism tests with prolactin. As part of the study, a machine learning tool was created using the R language to perform these analyses in an automated way. Methods: A cross-sectional study was conducted with 65,795 laboratory results from adult patients of both sexes, collected in the first half of 2018 at the Sabin Laboratory. The data, extracted and anonymized from the Laboratory Information System, included lipid parameters (total cholesterol, HDL-c, LDL-c, triglycerides) and biochemical/hormonal parameters (glucose, prolactin, insulin, HOMA-IR). Individual data were stratified into 106 partitions, based on the average concentrations of prolactin and lipid and glycemic metabolism analytes of each individual. These averages were used in three analyses: (1) in the comparison of the results of the glycemic and lipid metabolism tests in each range of the new metabolic classification of prolactin, (2) in the estimation of the inflection point through a machine learning model and the "gray zone" that represents the equivalent inflection points, associating the results of the glycemic and lipid metabolism tests with prolactin, and (3) in the prediction of the average results of these glycemic and lipid metabolism tests from the estimated inflection point. In addition, individual prolactin results were used to compare prolactin concentrations between sexes. Results: The analyzed population was aged between 21 and 75 years, composed of 51,366 women and 14,429 men. Hyperprolactinemia (prolactin concentrations above 25 ng/mL) was identified in 4,004 of the 51,366 women (7.79%) and in 208 of the 14,429 men (1.41%). Prolactin results were equivalent between sexes. The average results of the glycemic and lipid metabolism tests were significantly higher in the range of average prolactin results < 7 ng/mL. In the HomeoFIT-PRL range, corresponding to the range of the median and the distribution of the average results of the glycemic and lipid metabolism tests are predominantly lower compared to the other ranges of average prolactin results. Below the "gray zone" represented by the average prolactin results between 9.58 and 12.87 ng/mL, there may be impairments in glycemic metabolism, while for lipid metabolism, the estimated "gray zone" was 13.81 to 18.73 ng/mL. Conclusion: Our research confirms the correlation between variations in average prolactin concentrations and glycemic and lipid metabolism tests in humans, suggesting a mediating role of prolactin in the pathogenesis of impaired glucose and lipid metabolism. However, the cross-sectional nature of the study limits causal inference. Prospective studies with large data volumes and appropriate statistical approaches are needed to clarify the causeeffect relationship. The historical average of prolactin concentrations may offer more precise insights for understanding metabolic homeostasis. 

Rhipicephalus (B.) microplus, popularly known as “carrapato-do-boi”, is the species that most compromises cattle breeding productivity in the country. Additionally, this parasite has a major negative impact on commercial, environmental, and public health. Nowadays, several strategies are available for controlling, preventing, and eliminating agricultural pests and other pathogenic microorganisms such as bacteria and fungi. In this way, applying formulations with innovative multifunctional devices based on essential oils (OEs) has been finding great efficiency in combating these etiological agents, mainly the Syzygium aromaticum essential oil (OESA). This work aims to obtain and characterize an innovative multifunctional device based on microemulsions containing the essential oil of S. aromaticum, dispersed in a saponeic base developed by a saponification reaction. It is expected that such system, when in contact with the aqueous medium, releases eugenol, an active ingredient of OESA and responsible for controlling agricultural pests due to an extensive acaricidal, bactericidal, and fungicidal action. The methodology was developed based on an experimental design study, including a pseudo-ternary phase diagram, the formulation selection, the development and physical-chemical characterization of the microemulsion, the production of a soap base, and the evaluation of acaricides and microbiological activity. The results obtained demonstrated that all three formulations remained with adequate viscosity, yellowish, clear, and translucent. Among the developed formulations, formulation 02 (ME25, 2:8:6 OESA: T/Cot: water) was chosen for the other tests due to its promising characteristics. The results indicated PDI values lower than 0.3, demonstrating an excellent homogeneity in the droplet diameter distribution. The zeta potential varied between -27.1 and - 39.9 mV. The selected formulation had a pH of 8.50. The soap base presented a semi-solid appearance, even after drying, compromising the tableting process. As for the acaricidal activity, using OESA, pure, and in the microemulsion significantly inhibited the posture of the engorged females, demonstrating an effectiveness of almost 100%. As for the larval forms, the group containing pure and microemulsified OESA resulted in mortalities above 99% and 95%, respectively. The microbiological evaluation showed an antimicrobial activity for both pure and microemulsified essential oil, classified as strong inhibitors, as they had a Minimum Inhibitory Concentration (MIC) of up to 500µg/mL. Thus, it is concluded that the microemulsion containing the essential oil of S. aromaticum was obtained satisfactorily, proving to be adequate in its physicochemical aspects. Furthermore, both the essential oil itself and the microemulsion showed capable of combating the species Rhipicephalus (B.) microplus, suggesting an excellent acaricidal activity, in addition to a satisfactory antimicrobial activity, requiring further research and experiments to elucidate the mechanisms of action of the compound.

L-asparaginase is an enzyme used for the treatment of Acute Lymphoblastic Leukemia, which mostly affects children and teenagers. Currently, Brazil imports L-asparaginase without National Health Surveillance Agency registration, making it important to have a national production of this enzyme and the need to search for alternative production methods. One alternative would be cloning and expressing L-asparaginase from Fusarium proliferatum in Escherichia coli, with the aim of obtaining higher enzymatic productivity and reducing production costs. Another important factor would be the attenuation of adverse effects caused by treatment with enzyme obtained from prokaryotic sources, since Fusarium proliferatum is an eukaryotic microorganism. Therefore, the objective of this study was to clone L-asparaginase obtained from Fusarium proliferatum and express it in Escherichia coli BL21(DE3). The L-asparaginase gene from Fusarium proliferatum was identified and synthesized in pET-28a(+) vector with codon optimization for E. coli and NdeI/XhoI restriction sites. The vector was then transformed for replication in E. coli DH10B, with subsequent transformation for expression in E. coli BL21(DE3). After confirming the insertion of the vector in the expression system, clones were selected for evaluation of L-asparaginase production. SDS-PAGE and Western Blot were used to select the clone with the highest enzyme expression, followed by evaluation of the best cell lysis method. Once the clone and the most efficient cell lysis condition were defined, screening was performed to optimize cultivation conditions, varying the IPTG inducer concentration, post-induction time and induction temperature.The soluble and insoluble fractions were used for enzymatic assay, where asparaginase activity was measured by Nessler and ß-hydroxamate aspartic acid methods.

Introduction: Hearing impairment is one of the main disorders that can interfere with the development of speech and language. In an individual can cause significant communication difficulties, social isolation, negativo fcelings and depressive disorders. The Ilearing Aids (11As) and Cochlear implant (Cl) are options for profound and sevcre hca ring loss, and the Cl can he indicated for individuais who do not obtain benefits from IlAs. Objective: To evaluate the quality of life of individuais who underwent sequential bilateral cochlear implants (C1s) with a long surgical interval between procedures. Methods: Fifteen patients, ages 8 to 70, who underwent sequential bilateral CI, with an interval equal to or greater than 4 years between surgeries, were evaluated. Quality of life was evaluated using three questionnaires: WHOQOL - BREF, SSQ-12 and HHIA in Portuguese. Results: The WHOQOL-BREF questionnaire showed that the study participants had a good quality of life in ali domains tested. According to SSQ - 12, few reported inability to listen in communication situations. Most individuais were classified as having medium disability by the HHIA, but the social and emotional effects did not significantly affect the quality of life. Conclusion: The use of questionnaires to assess the quality of life of patients with hearing impairm ent is a valuable tool to measure adaptation to CI. Patients undergoing bilateral sequential CI, even with a long interval betwee n procedure s presented high indices of quality of life.

Patients with kidney failure on hemodialysis experience protein-energy wasting, loss of muscle mass and impaired physical function. Physical exercise during hemodialysis sessions appears to be a complementary therapeutic option to mitigate these characteristics. However, little evidence is available on long-term experience implementing this intervention as part of routine clinical practice. The present study aimed to investigate the feasibility of implementing a supervised intradialytic physical exercise program for patients on short-term daily hemodialysis. This is an observational, longitudinal and prospective study. Thirty-three patients were included. The physical exercise program consisted of a warm-up, lower and upper limb resistance exercises, lower limb cycle ergometer and cool down. Patients underwent the intervention during the first hour of hemodialysis, twice a week, supervised by physiotherapists and/or physical education professionals. Feasibility was assessed using the RE-AIM tool (Reach = Reach, Efficacy/Effectiveness, Adoption, Implementation, Maintenance) at individual and global levels.

“Introduction: Food consumption is not only driven by a desire for nutrients and satiety. Meals are also fundamental elements of human interaction and culture. While some patients in palliative care and terminality perceive nutrition as a hope for survival, others choose to stop eating and drinking voluntarily. Health professionals, caregivers, and family members are frequently involved in these situations. In this context, making decisions based on the best scientific evidence and the wishes of patients and families is essential. This review aims to obtain an overview of evidence-based knowledge and pinpoints existing knowledge gaps related to nutrition in palliative care and terminality to identify the actual knowledge regarding this topic and areas requiring further research. Methods: Data were retrieved from the Web of Science Core Collection on Octuber 2023, incluind articles published from January 2004 to September 2023. There was no language restriction. Bibliometrics and social network analysis were used to explore and map the knowledge structure, research hotspots, development status, authors, institutions, countries, journals, and development trends of nutrition in palliative care and terminality. The Bibliometrics, VOXviewer, Excel, and BibExcel software were used for the bibliometric analysis. Results: Two hundred eighty-nine articles were included, written by 1355 authors from 43 countries and published in 166 journals with an average of 5.2 co-authors per document and 22.2 citations per doc. The annual papers increased from four in 1994 to 35 in 2022, with a 2-year moving average of 29.5 between 2021 and 2022. “Healthcare Science & Services” were the most common WOS subject category. The United States contributed the highest number of articles. The keywords were stratified into sex clusters: "Comprehensive End-of-Life Care" (the largest category), "Advanced Cancer Nutritional Support", "Ethical Decision-Making in End-of-Life Choices", "Gastrointestinal Obstruction", and "Anorexia Nervosa". The trend topic analysis suggests an increase in the use of the terms related to patients' refusal of nutrition and artificial nutrition, assisted dying, anorexia nervosa, and eating disorders in the last years, shifting from the main themes, such as withdrawn and withholding Life-sustaining therapy in advanced cancer and dementia. Among the top 20 cited articles, although all papers addressed nutrition in palliative care and terminality in their content, it was the core element of the article in only nine papers. Conclusion: Even with the rising number of publications per year, the annual number of articles remains low, and the level of collaboration between countries and authors was found to be relatively low. Nutrition in palliative and terminal care has been little covered in journals specializing in nutritional therapy. It is worth mentioning that few articles evaluated perceptions surrounding the meaning of food in terminal illness, whether for patients or family members.

The use of 3D printing in the pharmaceutical area promises to revolutionize the drug therapy, having the complete customization of the dosage form as one of the main advantages of its use, with emphasis on the fused deposit modeling technique (FDM) that incorporates in its process technologies already used in the pharmaceutical industry, such as hot melt extrusion. With this technology the therapeutic possibilities have been expanded, since changes in the printing parameters can affect important characteristics of the drug, such as dosage and release profile. With the advances in this medicinal application of 3D technology, new aspects of therapy are being developed, such as the combination with other technologies of great impact, like nanotechnology. Nanotechnology has been demonstrating its impact for years in the pharmaceutical area, becoming even more important when polymeric materials associated with drugs are involved, due to the tendency of these materials to spontaneously form nanoparticles under certain dissolution conditions. With this, the present work aims to investigate 3D printing FDM as a reliable way to obtain pharmaceutical dosage forms and its correlation with nanotechnology, either by the spontaneous formation of the nanoparticles or by the inclusion of nanoparticles in formulations that will be printed. The first part of the study evaluated the impact of the 3D printing parameters in obtaining drug prototypes, highlighting the need for validation protocols to incorporate the technology in drug production. The second part of the study investigated the spontaneous formation of nanoparticles by the dissolution of 3D-printed tablets formulated with three different polymers and using naringenin as the model drug. The result demonstrated the formation of the particles in all the tested polymers, encapsulating a considerable amount of the drug, demonstrating the necessity to understand this process as a way to predict how these particles may affect the oral drug absorption. Finally, future perspectives are the incorporation of iron oxide nanoparticles into an oral pharmaceutical form made by 3D printing, investigating their dissolution process and the possibility of their use for the oral treatment of iron deficiency.

Introduction: the impact of voice problems in singers will be completely different from that to individuals with low vocal demand. For artistic voices, association between quality and demand is the most important aspect for a long-lasting career. Singers can be exposed to periods of long physical and vocal effort, increasing the risk of fatigue. Objective: The aim of this study is to contribute to the analysis of the relationship between low-level laser use and vocal fatigue. Methodology: 33 individuals took part in the study, 15 female and 18 male professional singers aged between 22 and 58. The participants did not have any self-reported vocal pathologies or injuries detected in otorhinolaryngological examination. In addition, they did not have any contraindications for laser therapy. Before singing, participants were randomly divided into three groups: the first was submitted to low-power laser, with red and infrared wavelengths, with a dose of 5J in 5 points of the larynx; the second was submitted to placebo laser therapy, and the third received no laser therapy. All participants answered the vocal self-assessment protocols: Modern Singing Handicap Index (IDCM) and Vocal Fatigue Index (IFV). Within 60min, they sang at high intensity in three moments of 15 minutes each, with a 5-minute break between them. After singing, they responded to the EASE-BR protocol at three times for 24 hours. Results: Participants who received laser had a lower EASE-BR score and an increase in maximum phonation time (MPT) in comparison with the groups that received placebo and no-laser therapy. No statistically relevant differences were found in the IFV and IDCM questionnaires. Conclusion: The study showed that the low-power laser had beneficial results regarding vocal fatigue, since the participants who received the laser obtained immediate post-performance results superior to those from groups that did not receive it, based on the analysis of the EASE-BR and MPT. However, the application of the laser in higher doses is suggested for comparison purposes, and in order to obtain ideal dosimetry.

The invasive lobular carcinoma, a special type of breast cancer, represents about 10% of this organ carcinomas. Associated to BRCA2 and CDH1 genes mutations, has a discohesive cellular phenotype, as a result of CDH1 gene pathogenic variants, which codifies E-cadherin adhesion molecules. Germline pathogenic variants are highly frequent in patients harboring Hereditary Diffuse Gastric Cancer syndrome and hereditary lobular breast cancer, in a dominant autosomal heritage and incomplete penetrance patternMore than 90% of them express estrogen and progesterone receptors, typically have low Ki67 and do not express HER2, belonging to the Luminal A molecular subtype, exhibiting a good prognosis when treated in the same way as non-special type carcinoma. Although there is currently no specific treatment for lobular carcinomas, there is pre-clinical description of increased ROS1 expression and synthetic lethality between E-cadherin deficiency and ROS1 tyrosine kinase inhibition, using ROS1 tyrosine kinase inhibitors, which results in apoptosis. However, there is no data in the literature correlating ROS1 expression in human tumors with E-cadherin expression and clinical-pathological data. The objective of the study was to analyze the potential of ROS1 expression, by immunohistochemistry, as a prognostic marker and to correlate the findings with "in silico" data from transcriptomes of CLIs in international open databases. This was an experimental cross-sectional study, approved by CEP/FS-UnB, with 79 cases of CLI, from the archives of two private and public institutions in Brasília, between 2015 and 2019. The mean age of the patients was 58.9 years, with data such as laterality, location, and multicentricity similar to those already described in the literature. ROS1, the main biomarker of the study, was expressed in only 3 cases, having H-scores ranging from 15 to 240. All three had Ki67 greater than or equal to 20% (P=0.026) and estrogen receptor expression in less than 20% of neoplastic cells (P=0.000015). No statistical significance was found between the pattern of ROS1 expression and histological type, histological grade, lymphovascular invasion, margin status, lymph node stage, TNM stage, progesterone receptor expression (PR), HER2 overexpression or low expression, or E-cadherin or p120-Catenin expression pattern. Despite the small number of cases with ROS1 expression in the study, suggesting a different cellular homeostasis pattern between humans and rodents, the correlation with higher rates of cell proliferation may correspond to a worse prognosis for patients who present it. The second arm of the study, correlating with "in silico" data, is ongoing and will be presented in a complementary manuscript.

Herbs are used for tea preparation, and as material for phytotherapy medicines, and both are largely used by the population. However, they may contain contaminants and residues that may pose a risk health to consumers, and their levels should be monitored. In this work, UHPLC-MS/MS methods for multiresidue analysis (MMR), ethylenebisdithiocarbamates (EBDC, mancozeb and metiram), a subclass of the dithiocarbamates fungicides, and its degradation product ethylenethiourea (ETU), responsible for chronic toxicity of the EBDC, were validated in different dry herbs. The extraction of samples in the MMR method is performed with acidified acetonitrile (ACN), magnesium sulfate (MgSO4), and sodium acetate (CH3COONa), followed by purification by dispersive solid-phase with secondary primary amine (PSA). Sample preparation for determination of EBDC includes complexation with EDTA in alkaline medium, derivatization to form EBDC-dimethyl using dimethyl sulfate solution in ACN, followed by addition of MgSO4, sodium chloride (NaCl), and PSA. In the ETU method, samples are extracted with ACN, adding L-cysteine, followed by MgSO4, NaCl, and PSA. A mixture of seven plants, which are composed by flower, leaf, stem and/or bark, was used as control for the validation of the methods, which were applied to analyze samples of 33 different herbs. MMR was validated for 65 pesticides, and the limit of quantification (LOQ) ranged from 0.05 to 0.025 mg/kg; 35% of the 75 samples analyzed were positive (≥ the limit of detection, LOD) for at least one pesticide, with carbendazim (up to 1.602 mg/kg), and imidacloprid being the most detected (38.7 and 30.7% of positive samples, respectively). Mancozeb was used to validate the EBDC method, with a LOQ of 0.03 mg/kg (0.02 mg/kg CS2); 16.5% of the 103 analyzed samples were positive (≥ LOD, up to 1.05 mg/kg or 0.59 mg/kg CS2). None of the 89 samples analyzed for ETU (LOQ of 0.03 mg/kg) were positive. Only two of the analyzed pesticides are registered in Brazil for use in the investigated herbs (linuron in chamomile, and methomyl in black mulberry), indicating that good agricultural practices are not being applied in herb cultivation. The daily intake of pesticides through the consumption of the dry herbs analyzed represent a maximum of 5% the pesticide acceptable daily intake (fenitrothion, arnica), which does not represent a potential risk to consumers. In this work, methods for the analysis of pesticide residues in dry medicinal herbs were satisfactorily validated and can be applied to the analysis of different herb types. 

“The therapy used for the physical transition in gender dysphoria is the Transsexualizing Hormone
Therapy, which leads to the acquisition of secondary sexual characteristics of the sex with which the
user identifies. To carry out a systematic survey of the literature in order to establish
recommendations based on the available evidence regarding hormonal drug therapy and nonhormonal
adjuvants used in the transsexualization process for transgender men and women over 18 

years of age. The work is of paramount importance for health professionals who work with this
population because it outlines a profile through a systematic review by formulating three questions,
namely: what are the inclusion and exclusion criteria for starting hormone therapy, what are the
laboratory tests that should be monitored and the immediate and late adverse effects that hormone
therapy can bring to this population of trans men and women. The search was structured in order to
answer three questions and was carried out from 01/01/2004 to 08/23/2020), in the following
databases: G-I-N, Medline (via PubMed), Embase and Cochrane. Among the 73 articles found, 51
were excluded in the process of removing duplicates, leaving 682. Of these, 499 were excluded
when reading the abstract because they fit the exclusion criteria. 183 articles were read in full and
121 were excluded. Only 62 articles met the inclusion criteria and these 43 were about the trans men
population and 42 about trans women. The evidence is still limited, due to the low quality of the
studies. The criteria for initiation of therapy involve correct diagnosis, ability to adhere and the
absence of pathological conditions that contraindicate the use of transsexualizing hormone therapy.
The changes in laboratory tests of the trans woman were close to what was expected in the
population of cis women, and the changes of the trans man are similar to that of the cis man. The
studies did not identify an increase in breast cancer cases in users using transsexualizing hormone
therapy, as well as the occurrence of adverse events were considered few and mild, such as
hypertension, pain at the administration site and alteration of the cardiovascular epidemiological risk
profile and coagulopathies. Ideas for starting transsexualizing sex therapy are well consolidated by
consensus. The ideal conditions for starting transsexualizing sexual therapy are well established by
consensus. Regarding the periodicity and the expected changes, the results are still largely based on
the literature from the treatment of hypogonadism in cis people, making more follow-up studies of
the transsexual population necessary. Although the studies have found mild adverse events, few 

have lasted longer than 5 years, and more prolonged follow-up studies are needed, given that the
perspective is that the treatment will continue throughout the user's life.”

“ Introduction: obesity is a chronic disease that already affects a large part of the world population. The increase in its incidence consequently causes an increase in diseases related to it, such as hypertension and DM2. Adipose tissue malfunction and inflammation – also resulting from macrophage infiltration – have been identified as the main causes of these disorders. The crucial role that PPARγ plays in both the regulation of adipocytes and inflammatory genes in macrophages has already been demonstrated. Previous studies indicate that GQ-16, a PPARγ partial agonist, has insulin sensitizing effects comparable to those of the full agonist rosiglitazone, but without inducing weight gain. Aim: to determine whether the beneficial effects of GQ-16 extend to the antiinflammatory effects of full PPARγ agonists, in order to obtain a therapeutic option to prevent obesity-induced inflammation and the consequent insulin resistance. Methods: RAW 264.7 murine macrophages and 3T3-L1 preadipocytes were cultured in a contact and transwell coculture system with subsequent 24-hour treatment with vehicle (DMSO 0.001%), Rosiglitazone (10-5M) and GQ16 (10-5M), in the presence and absence of inflammatory stimulus with LPS (100 ng/mL). Differentiated 3T3-L1 and RAW 264.7 cultivated separately were used as control, which received the same treatments as the coculture. Cells were harvested with Trizol and the relative mRNA expression of inflammatory and adipogenic genes was analyzed by real-time quantitative PCR (RTPCRq). Results: with regard to inflammatory genes (IL-6 and TNFα), only IL-6 had its gene expression increased with LPS treatment in contact coculture, and this effect was abolished when in the presence of agonists. In most treatments, the expression of both genes was more pronounced in the coculture than in the control. In relation to adipogenic genes, LPS was able to increase expression of only aP2 and GLUT4 in contact coculture. In the case of aP2 expression, this stimulus was intensified by ROSI+LPS. In contrast, GLUT4 expression decreased when the agonists were in the presence of LPS, however, this was only seen in the control. ADPN had no effect on either the contact coculture or the control. The three adipogenic genes, in most treatments, were less expressed in the contact coculture than in the control. In the transwell coculture, LPS increased the expression of only IL-6 and ADPN, and rosiglitazone, in the presence of the inflammatory stimulus, decreased and increased, respectively, this expression induced by LPS. The gene expression of aP2 and GLUT4 showed a tendency to increase in the treatment with ROSI+LPS compared to LPS alone, and, in the case of GLUT4, the trend was also present in the treatment with GQ+LPS. Conclusion: the interaction between macrophages and adipocytes seems to have a fundamental role for the expression of inflammatory genes, but not for the expression of adipogenic genes. GQ-16, in addition to having a lower adipogenic effect compared to rosiglitazone, also seems to have some anti-inflammatory effect, but further studies should be carried out to confirm this statement. ”

Brazil is one of the largest consumers of pesticides in the world. Recent studies show that these substances can act as endocrine disruptors, causing adverse effects in the body, including adipogenesis which can lead to weight gain and contribute to the development of obesity. Recent unpublished studies by the research group which I belong identified that the pesticides ametryn and carbosulfan have adipogenic effects on 3T3-L1 cells and that carbosulfan promotes PPARγ activation, a key regulator of adipogenesis. Taking into consideration these results and the scarce knowledge about the endocrine disrupting effect of pesticides, studies that investigate this topic are extremely relevant. The aim of this work was to investigate, in mammalian cells culture, other mechanisms that may be related to the adipogenic potential promoted by the pesticides ametryn and carbosulfan. Considering the results previously obtained, a transfection and gene reporter assay using HeLa cells was carried out to evaluate if cysteine 285 was important for the activation of PPARγ promoted by carbosulfan and also to evaluate if the pesticides would promote activation of GRα, PPARα and β, TRα and β and PXR. To evaluate if the lipid accumulation promoted by the pesticides occurred via PPARγ, a cell differentiation assay using 3T3-L1 cells was performed during 15 days. The cells were treated with the concentrations of the pesticides that promoted lipid accumulation, in the presence or absence of T0070907, a specific PPARγ antagonist. A RT-qPCR was also performed to compare the expression of inflammatory genes in 3T3-L1 cells treated with ametryn or rosiglitazone, that is a well-known PPARγ agonist with anti-inflammatory properties. As a result, the presence of the mutation in cysteine 285 abolished the transcriptional activity promoted by carbosulfan suggesting that the cysteine is essential for its activation and that carbosulfan can mimic endogenous ligands. Regarding the receptors investigated, none of the pesticides promoted activation of GRα, PPARα and β and TRα and β. However, carbosulfan promoted PXR activation and can be considered its partial agonist. In the cell differentiation assay with the antagonist was observed that the co-treatment reduced the lipid accumulation promoted by the tested pesticides, suggesting that this accumulation occurs via PPARγ. Regarding the expression of inflammatory genes, ametryn decreased their expression and in its highest concentration, the decrease was similar to that promoted by rosiglitazone but it’s worth mentioning that a higher concentration of ametryn was necessary to promote this effect. The results of this work allow greater knowledge about some pesticides used in Brazil but more studies are needed to understand their effects on complex organisms.

Infantile hemangioma (hi) is classified as a benign tumor of endothelial cells and affects a considerable portion of the infant population. Its manifestation can occur in a mild or more advanced form and, depending on the classification of the pathology, propranolol hydrochloride, the first-choice treatment, should be used to assist in the remission of hi. However, the systemic therapy used in pediatric patients can trigger several adverse effects in them, thus envisioning the need to develop topical formulations with this drug to reduce or even end these unpleasant effects. In view of the above problem, the present work is justified by the demand for new technologies for the management of hi that do not present unwanted effects in pediatric patients. Therefore, a development of nanostructured lipid carriers (ncl) with different sizes was proposed through a box-behnken predictive model using the microemulsion technique. The compatibility between the inputs involved in the production process was studied through the application of thermochemical analysis associated with centroid simplex experimental design. The nlcs were characterized in terms of average size, polydispersity index (pdi), zeta potency and encapsulation efficiency (ee). The performance of nanodispersions was evaluated according to release kinetics and permeation profile in vitro and in vitro studies in hbmec cells were conducted to evaluate the inhibitory potential of hi. As a result, nlcs of 500 and 900nm were obtained, with acceptable pdi given the difficulty in obtaining this type of formulation with low levels of polydispersion, and ee greater than 99.0%. The two formulations obtained controlled the release of ppl in 24 hours and its accumulation in the target tissue for topical therapy of hi. In addition, positive results of inhibition of cell proliferation were observed.

Amelogenesis imperfecta (AI) is a genetic condition characterized by quantitative and/or qualitative alterations of tooth enamel. AI can manifest in isolation or as a manifestation of some syndrome. In recent years, variants in 26 genes have been identified in cases of IA. The aim of this study was to carry out the clinical characterization and molecular diagnosis of four families with diagnostic hypothesis of autosomal recessive IA (AIAR) being followed-up in the Centro de Atendimento Odontológico de Doenças Raras, of the Hospital Universitário de Brasília. Clinical records were evaluated, blood from patients and families was collected for DNA extraction by the salting out method, and sent for exome sequencing. New variants were validated by Sanger sequencing. Sequences were analyzed on the Varstation® platform from Varsomics and Frankliin, Genoox. After signing the free and informed consent form, six patients from five families, previously diagnosed with hypoplastic AI, underwent molecular examination. Biallelic or homozygous variants in 3 different genes were identified. Variants in the LTBP3 gene (c.85_105delCTGCTGCTGCTGCTGCTGCTG, p. Leu29_Leu35del; c.3214C>T, p. Gln1072Ter) were detected in one patient who also had skeletal changes. Two patients with renal changes had variants in FAM20A, (c.343_362delTCGCTCCTGGCCAGCCAGGA, p. Ser115Glyfs*48 and c.406C>T, p. Arg136*; c.1112G>A, p. Trp371*); two sisters with isolated AI had a variant in RELT (c.3214C>T, p. Gln1072Ter); and in one patient no pathogenic variants were identified. The results of this study extend the knowledge of the orodental phenotype of patients with isolated and syndromic AI in Distrito Federal and the spectrum of variants in LTBP3, FAM20A and RELT genes. Furthermore, they highlight the importance of detailed phenotypic characterization, and of the multiprofessional team in the diagnosis of patients with AI.

“CONTEXT: Probiotics are live microorganisms of different species that can confer a benefit when ingested in a certain amount. Over the years, studies involving probiotics have developed to expand their use in areas such as disorders and allergies. On the other hand, studies in other areas of application are still needed so that probiotics can be used as an alternative intervention. As an example of this, there is an important question regarding giardiasis caused by protozoa of the genus Giardia. This disease afflicts populations around the world and sometimes alternatives that do not affect patients are necessary. Studies with probiotics have the potential for an alternative treatment of patients with parasitic diseases since their use promotes the balance of the intestinal flora, competing with the parasites and thus improving the condition of patients. However, most of the works that analyze this potential with probiotics are carried out in vitro or in vivo in Murine organisms. There are still few studies that analyze the effects of probiotics in humans affected with intestinal parasites. OBJECTIVE: To evaluate the use of probiotics as an alternative intervention for giardiasis in in vivo studies carried out with murines and whether it is possible to start human trials from that moment. METHOD: In this Systematic Review, eligibility criteria for inclusion of studies in the review were defined. Papers dealing with intestinal parasitic diseases were included, intervention studies with probiotics and in vivo studies with mice. Works that dealt with non-parasitic intestinal diseases were excluded; that do not use probiotics; who have co-intervention in the same group in their methodology; review studies and works that were not complete. The systematic review was registered in PROSPERO – International Prospective Register of Systematic Review. A definitive search was made in the databases on 02/17/2020 through a search strategy made with keywords found using the Mesh program in Embase databases; Lilacs; Livivo; Pubmed; Scopus; Web of Science and Gray Literature (Google Scholar; OpenGrey and ProQuest. EndNote web software, Rayyan QCRI were then used to assist in the management, removal of duplicates and selection of studies. To analyze the risk of bias for each study, the SYCLE checklist was used. The entire selection process was carried out by two reviewers (1R and 2R) independently and the third reviewer (3R) to break the tie when there is a disagreement between the first reviewers. Data from each article included in the selection steps were then collected by Reviewers 1 and 2 (1R and 2R) and these data were organized in a table to analyze the results found and the risk of bias in these studies.

Introduction: Duchenne Muscular Dystrophy (DMD) and Becker Muscular Dystrophy (DMB) neuromuscular diseases caused by dystrophin deficiency, with DMD being the most frequent in childhood. After the advent of ventilatory interventions and corticosteroid therapy, Dystrophic Cardiomyopathy (CD) became its major cause of mortality in DMD, but the diagnosis is still late due to its poorly symptomatic nature. The active search for CD may enable early cardioprotection and, consequently, a better prognosis, while research in curative therapies advances. Noninvasive imaging has already been consolidated as effective instruments of this evaluation. The validation of serum biomarkers as predictors can help in the detection and stratification of CD risk. Objective: to evaluate the correlation between the Type B Atrial Natriuretic Peptide (Pro-BNP) and the subclinical cardiac alterations measuredby EcoStrain in patients with Duchenne Muscular Dystrophy (DMD) andBecker (DMB) in a reference outpatient clinic for neuromuscular diseases. Methods: observational and analytical study of longitudinal and prospective design with children and adolescents with DMD and DMB followed at the Children's Hospital of Brasilia José Alencar - Federal District - Brazil. Medical records, clinical examination, electrocardiogram, laboratory tests, echocardiogram and Holter were performed, with intervention after the first tests, when indicated, and clinical reassessmentand with tests in two other times, during a mean follow-up of 12 months. Descriptive and association analysis, agreement and correlation was performed through the IBM SPSS (Statistical Package for the Social Sciences) program 23, 2015. The significance level used in the entire study was 5%. Results: The study included 28 boys (27 DMD and 1 DMB), with a mean age of 10.1 years, being more than 70% asymptomatic and without alterations in cardiovascular physical examination, 90% without functional alterations to conventional Echocardiogram and 93.75% with changes in the Longitudinal Global Strain (GLS). The Shortening Fraction (SF) and the Ejection Fraction -Teicholz (LVEF-Tz) decreased significantly throughout the study, the intervention did not change the parameters and there was no agreement between Pro-BNP and SGL, and this analysis was impaired by the absence of normal GLS values in the sample. Conclusions: The EcoStrain detected subclinical myocardial dysfunction in patients who were still very young, and there was no agreement with pro-BNP values. LVEF-Tz and SFdecreased significantly and the intervention did not alter echocardiographic parameters throughout thestudy.

Cell senescence is a biological response resulting from aging and chronic stress mainly characterized by a permanent state of cell cycle arrest. Evidence indicates that senescence can affect important functions of the dental pulp such as tissue defense and repair. This work evaluated possible morphological changes, in addition to the migratory and proliferative capacity and effects on the immune response of human dental pulp cells (CEP/UCB 4,714,331). Initially, the cells were treated with doxorubicin to induce senescence. Confirmation of induction was performed by β-galactosidase staining. Then, the morphological changes were evaluated through scanning electron microscopy, proliferation by counting cells not stained by trypan blue, and migration by the Scratch method. It was possible to observe morphologically an increase about cell size and a decrease in the number of cell extensions about morphology (p>0.03). Regarding proliferation capacity, a reduction of 36% at 24h and 35% at 48h (p<0.05) was observed, in addition to a decrease in migration capacity after senescence induction (p> 0.05). In this way, senescence was shown to be harmful to the proliferative and migratory capacity, in addition to affecting cell morphology

Music can be considered one of the most complex and multi-domain stimuli for the brain. Among the elements that constitute music, rhythm is a central and indispensable structure, as it orders the movement of musical patterns in time and provides support to other musical structures. Studies using neuromodulation techniques such as transcranial direct current stimulation (tDCS) have demonstrated changes in perceptual, cognitive and behavioral functions. Studies with musicians indicate that musical performance can be improved with the application of tDCS on regions such as the motor area and cerebellum. It is also inferred that tDCS may help to reduce the effects of age on cognition and brain activity. Considering these aspects, the objective of the present study was to investigate the effects of tDCS on the perception and rhythmic-musical production in elderly people with musical training. The study included 48 elderly people aged between 60 and 86 years, divided into two groups, 25 with musical training and 23 without musical training. Of the participants with musical training, 10 (40%) underwent stimulation by anodic tDCS in the cerebellum and 15 (60%) in the motor area (M1). Among the participants without musical training, 10 (43.48%) received stimulation in the cerebellar area and 13 (56.52%) in the motor area. The instrument used to identify the rhythmic nuances of the research subjects was the H-BAT test (Harward Beat Assessment Test). The following instruments were used to verify executive functions: MoCA, STROOP test, CANTAB battery tests - Cambridge Neuropsychological Test Automated Battery: MOT (Motor Screening Task) SWN (Spatial Working Memory), PAL (Paired Associates Learning). The SEQTAP (Sequential Finger Tapping Task) was used to track motor capacity/performance. The STROOP, SEQTAP and H-BAT tests were performed in two sessions, separated by a period of one week. Within each session, a pre and post-tDCS test of all tests was performed, with the exception of the MoCA, MOT, SWM and PAL tests. The tests were performed before and after stimulation by tDCS, applied for 20 minutes in the cerebellum and in the left motor area (M1). The results of the study revealed, in relation to executive functions, a mild cognitive impairment in most of the sample. Few benefits of tDCS were found in cognitive tests. Significant differences were concentrated in the group of individuals without musical training. Stimulation in the motor area apparently produced more significant differences compared to the cerebellar area. Regarding sensorimotor synchronization, the results suggest that tDCS produced a significant effect on the consistency and accuracy of synchronization rates verified from the MTT test, both for individuals with training and for participants without musical training. The possible effects were verified mainly in the motor area (M1). Regarding the rhythmic-musical perception, probable effects of stimulation by tDCS were observed in the two stimulated areas, and the effects resulting from cerebellar stimulation were mainly concentrated among participants without musical training. In comparison with the cerebellum, the motor area showed more satisfactory results from neuromodulation. Finally, regarding the learning of the motor typing task, the findings related to the SEQTAP test, the probable significant effects were verified mainly in individuals with musical training, with greater effect of stimulation in the motor area (M1). Future research with longitudinal profiles may represent an important format to increase data regarding the effects of stimulation by tDCS in the motor areas (M1) and cerebellum on the perception and rhythmic-musical production of elderly individuals.

Naringenin is a bioflavonoid found primarily in citrus fruits such as Citrus aurantium L. It has many pharmacological benefits, including anti-atherogenic, anti-inflammatory, and anti-cancer, but low oral bioavailability. Considering the possibility of a systemic antiinflammatory effect via the transdermal route, the aim of this work was to develop a transdermal film of chitosan containing naringenin and to evaluate the cutaneous permeation of the drug from it. A simple, accurate and selective HPLC method for determination of naringenin in formulation and in in vitro studies was developed and validated. In mononuclear cell assays, naringenin induced an increase in two antiinflammatory markers (IL-10 and TGF-β1) from 1,0 µg/mL. In addition, it could reduce the expression of IL-1β and the proliferation of T lymphocytes, which has a pro-inflammatory role. After verifying the compatibility of naringenin with chitosan by means of thermal analysis tests, DD≥75% chitosan films were prepared in acidic solution. Then, naringenin (0.5% w/w) was incorporated into the polymer solution, which was subjected to a drying process for 12 h at 60 °C. The films were characterized and the stability evaluated over 90 days. Thus, a flexible and thick chitosan film (0.04 µm) containing naringenin was developed, which demonstrated adequate homogeneity in the content tests, in addition to a rupture strength of 8.81 ± 0.18 N. Considering the content, the film remained stable for 30 days. Naringenin was progressively released to the physiological media following both first order (R² = 0.97) and Korsmeyer-Peppas (R² = 0.91) kinetics. When topically applied, the chitosan film could stimulate a constant and continuous diffusion of drug across the skin over 72 h. Indeed, the permeation flux of naringenin was 0.30 ± 0.01 µg/cm²/h, which means a concentration in the receptor solution 14-fold (p<0.05) higher than that provided by the drug solution used as a control. Therefore, the chitosan films containing naringenin demonstrated physical and organoleptic characteristics suitable for dermal use and could increase the phytochemical absorption through the skin. Thus, the developed film should be a promising alternative for the treatment of inflammatory conditions for prolonged periods by the transdermal route.

Issue: The findings in the literature indicate inconsistency in the complications caused by implant of electrodes in the cochlea; vestibular alterations and balance disorders are mentioned as the most likely. Purpose: To evaluate, in the literature, through the results of multiples vestibular function tests, the effects of cochlear implant surgery on postural stability in adult patients and to analyze. Hypothesis: From the PICO strategy, where Population focuses on adults, Intervention is cochlear implant surgery, Comparisons between implanted patients and Outcomes are the results of the assessment of cochlear function, the research question was formulated: Are there deficits in vestibular function in adults undergoing cochlear implant placement? Method: Systematic review based on cohort, case-control, and cross-sectional observational studies. Information sources: Databases between 1980 and 2021: PubMed, Cinahl, Web Of Science, Cochrane, and Scopus. Search strategy using Mesh terms: "Adult", "Cochlear Implant", "Postural Balance", "Posturography", "Cochlear Implant", "Dizziness", "Vertigo", "Vestibular Functional Tests" and "Caloric Tests". Populational Inclusion criteria: Studies with adult patients; Intervention: cochlear implant placement surgery; Comparison: Analysis of vestibular function with vestibular test results and pre- and postoperative symptoms; Outcome: Studies with at least one of the vestibular function tests: computerized vectoelectronystagmography (VENG), Vestibular evoked myogenic potentials (VEMPs), Caloric test, Video Head Impulse Test (VHIT), Head Impulse Test (HIT), Videonystagmography (VNG) and Static and Dynamic Posturography. Exclusion criteria: studies without records of pre- and postoperative data collection and studies with populations under 18 years of age. Screening based on the reading of abstracts and titles was performed independently by two reviewers. At the end, with the intermediation of a third reviewer, manuscripts were included. Risk of bias analysis, performed by two other authors, occurred using the JBI "Critical Appraisal Checklist". Results: Of the 757 studies, 38 articles met the inclusion criteria. VEMP was the most commonly used test by the studies (44.7%), followed by caloric test (36.8%), and vHIT (23.6%). Most studies performed more than one test to assess vestibular function. Conclusion: Among all vestibular tests investigated, the deleterious effects on vestibular function after cochlear implant surgery were detected with statistical significance (P<0,05) using VEMP and Caloric Test. Comparing abnormal and normal results after implant surgery, the vestibular apparatus was evaluated as abnormal results after cochlear implant surgery only in the VEMP test. The other tests analyzed maintained a mostly percentage considered normal results

Some systemic pathological conditions such as skeletal dysplasias can lead to craniofacial alterations and are potential risk factor for temporomandibular joint development (TMJ) and masticatory system functioning. Osteogenesis imperfecta (OI) is a skeletal dysplasia and is considered a group of rare genetic disorders characterized by different degrees of bone fragility and increased susceptibility to fractures. bone and deformity. Extra-skeletal manifestations such as ligament laxity, muscle hypotonia, malocclusion and dentinogenesis imperfecta are frequently observed and can affect the craniofacial complex. Although many OI patients present orofacial manifestations, disruption involving the TMJ and their possible functional consequences, as well as their impact on emotional and behavioral aspects, are poorly reported in the literature. This study had two objectives: (1) to evaluate the influence of OI and its treatment on TMJ development through the characterization of the trabecular bone in the mandibular condyle; (2) to assess the impact of orofacial alterations and OI severity on the Oral Health-related Quality of Life index (OHRQoL) of patients. For the first objective, fractal dimension (FD) analysis of the condyle region was performed on panoramic radiographs of 33 patients (2-17 years old) treated with disodium pamidronate and compared with a control group of 99 individuals without OI. Effect of cumulative pamidronate dose, duration of treatment, and age at treatment onset on FD outcomes were evaluated using a linear regression model with mixed effects. For the second objective, the Brazilian version of the Child Perception Questionnaire (CPQ) was applied to children and adolescents grouped by age (8- 10 and 11- 14 years old). The relationship between the OHRQoL index and its health domains, OI types of and the presence of orofacial manifestations was evaluated. FD in patients was significantly lower compared to healthy adolescents (p < 0.01). The mean FD in the study group was 1.23 (± 0.15), and 1.29 (± 0.11) among controls. There was no statistically significant difference in this result regardless of sex. The type of OI, age at treatment onset and duration of therapy were variables that had a statistically significant effect on FD. The OHRQoL index for patients between 8 and 14 years old was 6.89 ± 6.59. It was lower among OI type III patients (5.9 ± 5.47) than in type IV patients (6.88 ± 5.47). 8.77). The index was lower for children (6.59 ± 7.06) than for adolescents (7.4 ± 6.04). This study demonstrated that the bone architecture of the condyle may be altered in pediatric patients with moderate and severe forms of OI. Furthermore, pamidronate treatment seems to affect this natural history, making the trabecular bone structure of the condyle more complex. It also demonstrated that HoRQoL was similar in patients with moderate and severe OI. The oral symptoms domain is the most relevant for the index among patients aged 8 to 14 years. The perception of HRQoL among adolescents was worse than among children.

Introduction: The quantity and intensity of coronary lesions and left ventricular function are important factors in the prognosis of coronary artery disease (CAD), as demonstrated in studies carried out in the 70s and 80s of the 20th century. More recently, the concept of optimized drug therapy (OMT) and the use of metallic stents and later drug-eluting stents in percutaneous coronary intervention (PCI) procedures. A scientific study that evaluated the degree of coronary disease and left ventricular function did not show an improvement in the prognosis of CAD despite the institution of BMT and PCI with the use of stents.4 However, this study excluded patients with trunk injury from its target population. coronary artery disease and left ventricular ejection fraction below 30%. The novelty of this work consists in the lack of data on which type of population and which results (success, survival) are achieved in practice in the Health System of the Federal District. In addition, there is still disagreement about the best therapeutic strategy for CAD. The present study aims to evaluate the prognosis of patients with CAD treated at the public health service according to the severity of coronary disease and left ventricular dysfunction, being, therefore, a more adequate record of the incorporation of BMT concepts into clinical practice. and PCI with Stents, in addition to coronary artery bypass grafting in a general population. Objectives: The primary objective is to evaluate the mortality of patients with coronary artery disease, treated at the public health service of the Federal District. Methods: The records of the Hemodynamics Services of the Tertiary Public Hospitals of the Federal District from January 2013 to December 2015 will be reviewed to survey the target population of the study; individuals with CAD undergoing left heart catheterization with coronary angiography. The medical records of the patients will be accessed in the electronic medical record system and the reports of the coronary angiographies performed will be analyzed in terms of anatomical severity and left ventricular function. Statistical analysis: For clinical characteristics, the distribution of variables and their normality will be checked using histograms, scatter plots and the Kolmongorov-Smirnoff and Shapiro-Wilk tests. For comparison between the mentioned groups, the chi-square tests will be used for categorical variables and the analysis of variance (ANOVA) for non-categorical variables. Results:From January 2013 to December 2015, 7,392 individuals with CAD treated in the public health network of the Federal District underwent CCG. Of these, 750 had stable angina, 1,376 unstable angina, 1,401 acute myocardial infarction without STsegment elevation and 1,689 acute myocardial infarction with ST-segment elevation. One thousand six hundred and eighty-four individuals had diabetes mellitus (DM), 485 being insulin-dependent (IDDM) and 1,199 non-insulin-dependent (NIDMD). Smoking was present in 1,893 individuals, dyslipidemia in 1,084, systemic arterial hypertension in 3,745, family history of CAD in 616, obesity in 336 and atrial fibrillation (AF) in 177. Males predominated in the sample. Optimized drug therapy was the option for 4,642 (62.8%) individuals, of whom 2,786 (37.7%) had significant CAD. Percutaneous coronary intervention was the option for 2,179 (29.5%) subjects and coronary artery bypass graft surgery was the option for 571 subjects (7.7%). Mortality when comparing the type of treatment proposed showed no difference. Mortality was higher in individuals with extensive coronary atherosclerotic disease, regardless of the proposed treatment. Mortality was higher in diabetic subjects when compared to non-diabetic subjects. Mortality was higher in individuals in whom antiplatelet therapy was not adequately prescribed by current standards.Conclusion: Mortality was higher in individuals with extensive coronary artery disease, diabetes mellitus and in those in whom anti-platelet aggregation therapy was not adequate for their clinical condition. There was no difference in mortality when compared to the therapeutic modality adopted.

Inhibition of systemic inflammation has been a beneficial strategy in treating several noncommunicable diseases, which represent one of the major causes of mortality in the world. The Peroxisome Proliferator-Activated Receptors (PPAR) are interesting pharmacological targets, since they can act both through the metabolic and anti-inflammatory pathways. Morus nigra L. has flavonoids in its chemical composition with recognized antioxidant activity and often associated with anti-inflammatory activity. Therefore, this study aimed to evaluate the hydroethanolic extract of M. nigra leaves' ability to activate PPARs and promote anti-inflammatory effects in lipopolysaccharide (LPS)-stimulated murine macrophage cells. The leaf extract was prepared by cold maceration, and the chemical profile was obtained by HPLC-DAD. The cytotoxicity of the extract was tested by the MTT method on RAW 264.7 and HeLa cells. Activation of the PPAR  and γ, and the Tr was tested using the luciferase genereporter assay in HeLa cells. The anti-inflammatory capacity of the extract was evaluated after the treatment of LPS-stimulated RAW 264.7 cells. HPLC analysis revealed the presence of rutin (3.74 µg/mg) and isoquercitrin (5.92 µg/mg). Low extract cytotoxicity was observed for the tested strains. The extract showed agonist activity for both types of PPAR ( and γ), but its major compounds (rutin and isoquercitrin) did not significantly activate the receptor. The extract was able to reduce the production of nitric oxide, reactive oxygen species and the pro-inflammatory cytokine TNF-α. Treatment with the specific PPAR-α antagonist, GW 6471, was able to partially block the anti-inflammatory effect caused by the extract. Thus, possibly the anti-inflammatory effect of the extract can be attributed, at least in part, to the activation of the PPAR-α receptor, being the first study to evaluate the activation of this receptor by the extract of the leaves of M. nigra L.”

Chemotherapy-induced peripheral neuropathy (CIPN) is a clinical manifestation of several classes of antitumor drugs, such as platinum derivatives. Cisplatin is an antitumor widely used in oncology practice due to its ability to induce apoptosis in tumor cells as a result of the formation of platinum adducts in DNA. However, in neurons, cisplatin induces changes that will culminate in peripheral neuropathy, a set of symptoms characterized by being predominantly sensory and dose-dependent. Among these symptoms are paresthesia, sensory loss and neuropathic pain, which can be acute or chronic. These effects occur because the neurons of the dorsal root ganglia (DRGs) are the targets of these drugs. Given this, developing strategies aimed at protecting the nervous system is essential for CIPN treatment. Thus, the purpose of this work is to evaluate in vitro whether aqueous extract of Eugenia dysenterica leaves (plant from Cerrado popularly known as Cagaita) has a neuroprotective role in the CIPN model. These hypotheses are supported due to the antioxidant and anti-inflammatory activities of this plant, in addition to the neuroprotective effect already demonstrated in other neurotoxicity models. Thus, primary cultures of DRG cells from adult rats and neuron-like PC-12 cells were established, which were treated with E. dysenterica extract in the presence or absence of cisplatin. The effects of these treatments on cisplatin neurotoxicity were evaluated using the techniques of evaluating cell viability, quantification of calcitonin gene-related peptide (CGRP) release and quantification of total CGRP, quantification of mRNA for Superoxide dismutase 2 (SOD2) and NRF2, the release of Interleucin-1b (IL-1b), the synthesis of reactive oxygen species and the measurement of neurites. We observed that treatment with 30 µM cisplatin for 24 hours did not induce cell death in DRG cells, increased neuronal sensitization and induced oxidative stress in PC-12 cells, which were prevented by pretreatment with 30 µg/mL of E. dysenterica extract. Furthermore, we observed that cisplatin promotes increased IL-1b release, SOD-2 gene synthesis and inhibition of neurite outgrowth. On the other hand, treatment only with 30 µg/mL of E. dysenterica extract also does not alter the cell viability of DRG cells, IL-1b release and SOD-2 gene expression, however it reduces Nrf2 expression. Furthermore, we observed that the extract does not interfere with the cisplatin antitumor activity or its effect on neurites. We also observed that Nrf2/Keap1/ARE pathway activators, oltipraz and sulforaphane, induced neuronal sensitization. In summary, our data demonstrate that E. dysenterica extract can be a promising tool for the treatment of cisplatin-induced PN.